Transcript asmbl_113609

Sequence
Transcript Sequence for observation asmbl_113609 of TGE0002181:
GTGTATTTGTAAAGTGCAGTCAGATTTTGTTGTACGGAAGACGGGACTGTGATGCCTTGCAATTTCCCTCTGCCTTTTGCATTACATGGCGCCGCCATCTTGAGCAGAAATGTATCATGGGGCTCGCCATTTTGCATGGTCGAGCGGGTATTTCCGGTTCCGGCGGGGGGCTTTTCTCTCTCTCTTTCACTGCAAGGCGGCGGCAGGAGAGGTTGTGGTGCTAGTTTCTCTAAGCCATCCAGTGCCATCCTCGTCGCTGCAGCGACACACGCTCTCGCCGCCGCCATGACTGAGCAGATGACCCTTCGTGGCACCCTCAAGGGCCACAACGGCTGGGTAACCCAGATCGCTACTACCCCGCAGTTCCCGGACATGATCCTCTCCGCCTCTCGAGATAAGACCATCATCATGTGGAAACTGACCAGGGATGAGACCAACTATGGAATTCCACAGCGTGCTCTGCGGGGTCACTCCCACTTTGTTAGTGATGTGGTTATCTCCTCAGATGGCCAGTTTGCCCTCTCAGGCTCCTGGGATGGAACCCTGCGCCTCTGGGATCTCACAACGGGCACCACCACGAGGCGATTTGTGGGCCATACCAAGGATGTGCTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTGCTGCCACAGGCCCCAGCATCAAGATCTGGGATTTAGAGGGAAAGATCATTGTAGATGAACTGAAGCAAGAAGTTATCAGTACCAGCAGCAAGGCAGAACCACCCCAGTGCACCTCCCTGGCCTGGTCTGCTGATGGCCAGACTCTGTTTGCTGGCTACACGGACAACCTGGTGCGAGTGTGGCAGGTGACCATTGGCACACGCTAGAAGTTTATGGCAGAGCTTTAC