Transcript asmbl_113360

Sequence
Transcript Sequence for observation asmbl_113360 of TGE0059538:
ATTGGCCTCTGCGCGCCACGTGTCCGGCTCGGAGCCCACGGCTGTCCTCCCGGTCCGCCCCGCGCTGCGGTTGCTGCTGGGCTAACGGGCTCCGATCCAGCGAGCGCTGCGTCCTCGAGTCCCTGCGCCCGTGCGTCCGTCTGCGACCCGAGGCCTCCGCTGCGCGTGGATTCTGCTGCGAACCGGAGACCATGGCCAAACCAGCACAGGGTGCCAAGTACCGGGGCTCCATCCATGACTTCCCAGGCTTTGACCCCAACCAGGATGCCGAGGCTCTGTACACTGCCATGAAGGGCTTTGGCAGTGACAAGGAGGCCATACTGGACATAATCACCTCACGGAGCAACAGGCAGAGGCAGGAGGTCTGCCAGAGCTACAAGTCCCTCTACGGCAAGGACCTCATTGCTGATTTAAAGTATGAATTGACGGGCAAGTTTGAACGGTTGATTGTGGGCCTGATGAGGCCACCTGCCTATTGTGATGCCAAAGAAATTAAAGATGCCATCTCGGGCATTGGCACTGATGAGAAGTGCCTCATTGAGATCTTGGCTTCCCGGACCAATGAGCAGATGCACCAGCTGGTGGCAGCATACAAAGATGCCTACGAGCGGGACCTGGAGGCTGACATCATCGGCGACACCTCTGGCCACTTCCAGAAGATGCTTGTGGTCCTGCTCCAGGGAACCAGGGAGGAGGATGACGTAGTGAGCGAGGACCTGGTACAACAGGATGTCCAGGACCTATACGAGGCAGGGGAACTGAAATGGGGAACAGATGAAGCCCAGTTCATTTACATCTTGGGAAATCGCAGCAAGCAGCATCTTCGGTTGGTGTTCGATGAGTATCTGAAGACCACAGGGAAGCCGATTGAAGCCAGCATCCGAGGGGAGCTGTCTGGGGACTTTGAGAAGCTAATGCTGGCCGTAGTGAAGTGTATCCGGAGCACCCCGGAATATTTTGCTGAAAGGCTCTTCAAGGCTATGAAGGGCCTGGGGACTCGGGACAACACCCTGATCCGCATCATGGTCTCCCGTAGTGAGTTGGACATGCTCGACATTCGGGAGATCTTCCGGACCAAGTATGAGAAGTCCCTCTACAGCATGATCAAGAATGACACCTCTGGCGAGTACAAGAAGACTCTGCTGAAGCTGTCTGGGGGAGATGATGATGCTGCTGGCCAGTTCTTCCCGGAGGCAGCGCAGGTGGCCTATCAGATGTGGGAACTTAGTGCAGTGGCCCGAGTAGAGCTGAAGGGAACTGTGCGCCCAGCCAATGACTTCAACCCTGACGCAGATGCCAAAGCGCTGCGGAAAGCCATGAAGGGACTCGGGACTGACGAAGACACAATCATCGATATCATCACGCACCGCAGCAATGTCCAGCGGCAGCAGATCCGGCAGACCTTCAAGTCTCACTTTGGCCGGGACTTAATGACTGACCTGAAGTCTGAGATCTCTGGAGACCTGGCAAGGCTGATTCTGGGGCTCATGATGCCACCGGCCCATTACGATGCCAAGCAGTTGAAGAAGGCCATGGAGGGAGCCGGCACAGATGAAAAGGCTCTTATTGAAATCCTGGCCACTCGGACCAATGCTGAAATCCGGGCCATCAATGAGGCCTATAAGGAGGACTATCACAAGTCCCTGGAGGATGCTCTGAGCTCAGACACATCTGGCCACTTCAGGAGGATCCTCATTTCTCTGGCCACGGGGCATCGTGAGGAGGGAGGAGAAAACCTGGACCAGGCACGGGAAGATGCCCAGGAAATAGCAGACACACCTAGTGGAGACAAAACTTCCTTGGAGACACGTTTCATGACGATCCTGTGTACCCGGAGCTATCCGCACCTCCGGAGAGTCTTCCAGGAGTTCATCAAGATGACCAACTATGACGTGGAGCACACCATCAAGAAGGAGATGTCTGGGGATGTCAGGGATGCATTTGTGGCCATTGTTCAAAGTGTCAAGAACAAGCCTCTCTTCTTTGCCGACAAACTTTACAAATCCATGAAGGGTGCTGGCACAGATGAGAAGACTCTGACCAGGATCATGGTATCCCGCAGTGAGATTGACCTGCTCAACATCCGGAGGGAATTCATTGAGAAATATGACAAGTCTCTCCACCAAGCCATTGAGGGTGACACCTCCGGAGACTTCCTGAAGGCCTTGCTGGCTCTCTGTGGTGGTGAGGACTAGGGCCACAGCTTTGGCGGGCACTTCTGCCAAGAAATGGTTATCAGCACCAGCCGCCATGGCCAAGCCTGATTGTTCCAGCTCCAGAGACTAAGGAAGGGGCAGGGGTGGGGGGAGGGGTTGGGTTGGGCTCTTATCTTCAGTGGAGCTTAGGAAACGCTCCCACTCCCACGGGCCATCGAGGGCCCAGCACGGCTGAGCGGCTGAAAAACCGTAGCCATAGATCCTGTCCACCTCCACTCCCCTCTGACCCTCAGGCTTTCCCAGCTTCCTCCCCTTGCTACAGCCTCTGCCCTGGTTTGGGCTATGTCAGATCCAAAAACATCCTGAACCTCTGTCTGTAAAATGAGTAGTGTCTGTACTTTGAATGAGGGGGTTGGTGGCAGGGGCCAGTTGAATGTGCTGGGCGGGGTGGTGGGAAGGATAGTAAATGTGCTGGGGCAAACTGACAAATCTTCCCATCCATTTCACCACCCATCTCCATCCAGGCCGCGCTAGAGTACTGGACCAGGAATTTGGATGCCTGGGTTCAAATCTGCATCTGCCATGCACTTGTTTCTGACCTTAGGCCAGCCCCTTTCCCTCCCTGAGTCTCTATTTTCTTATCTACAATGAGACAGTTGGACAAAAAAATCTTGGCTTCCCTTCTAACATTAACTTCCTAAAGTATGCCTCCGATTCATTCCCTTGACACTTTTTATTTCTAAGGAAGAAATAAAAAGAGATACACAAACACATAAACACATTTCCAGTGAGGGCCTCTGTCTTCTACCTAGAGCCTGCAGCCTGGATTTTCCTCATTAGAGCTTGAGGTTGTAAAGTCTGTCCAGGAGCGAGTTACGTCTTTAAATTCTTGCAAGGTGTTTCCCGGGAAGCGCACAGGAGAATCTGAGTTTGCAGCAAGCCTGGGAAGGCTGGCCCAGCCCTGCTCCGGGCCTCAGGTTCCCCCTCATCCCCTCTCGCTGTCTGGACATTTCTGTATGCTCTTCATCCATTTCAACCAAGCCCAAACTTCCTCTTTTGAACTATGCAAGGGTGCCCGATGTGATCTTGATCTGGAGAGGTGCATGGAAAGTTTCCTTCATGCAGGTCACTGATAAGCAAGTAGGCGCAACTGCAGTTCCTCTGCCTTCCCTCCCCCGCTGCCCTACTTCTGGTCTGTGGCTTTGGTCTAAGATTGTCCAGTGACCATGGCATGGGGCTGGCTGCTGGCCAAAGGGCACTTCTCCCTACCCTGGCTGACCAGACTAGTTTATTGCAGGTTAGCGCGTGTTTGTTTTCTTTTCTTTCTTTTCTTTTTCTTCTTTTTTTTTT