Transcript asmbl_113347

Sequence
Transcript Sequence for observation asmbl_113347 of TGE0059537:
CTGCCCCGCAAAAGGCAGCTTCACCAAAGTGGGGTATTTCCAGCCTTTGTAGCTTTCACTTCCACATCTACCAAGTGGGCGGAGTGGCCTTCTGTGGACGAATCAGATTCCTCTCCAGCACCGACTTTAAGAGGCGAGCCGGGGGGTCAGGGTCCCAGATGCACAGGAGGAGAAGCAGGAGCTGTCGGGAAGATCAGAAGCCAGTCATGGATGACCAGCGCGACCTTATCTCCAACAATGAGCAACTGCCCATGCTGGGCCGGCGCCCTGGGGCCCCGGAGAGCAAGTGCAGCCGCGGAGCCCTGTACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGCACCATTGGCTCCTGTTTGAAATGAGCAGGCACTCCTTGGAGCAAAAGCCCACTGACGCTCCACCGAAAGAGTCACTGGAACTGGAGGACCCGTCTTCTGGGCTGGGTGTGACCAAGCAGGATCTGGGCCCAGGTAAGGGCCTTGCAGAGGGGCATCTGGTCACCAGCAGCTCATCCCCAGCAGGGCCAGCTCCTTTGTGGGCAGGTGAAGGAGTGTGACGCTGGGCCACTCTCCAACATTCCTGGGATGTCCATTTCACAGACGAAGGAACAGGGTTGGGGGGCTGTGGGGAGTTACACAAATCCATGATGGTCATTATTGGACCTGAGCAGGGGGCAGGGGAGGGTGGACAGTCCTTAACTGCTCTGCAGGTCCAGGATGTTAGAAAGGGGCAGGGACAACAAATGGGTGACCCCAACCTCAACCTGCTGCTTCTCTCTCCAGTCCCCATGTGAGAGCAGCAGAGGCGGTCTTCAACATCCTGCCAGCCCCACACAGCTACAGCTTTCTTGCTCCCTTCAGCCCCCAGCCCCTCCCCCATCTCCCACCCTGTACCTCATCCCATGAGACCCTGGTGCCTGGCTCTTTCGTCACCCTTGGACAAGACAAACCAAGTCGGAACAGCAGATAACAATGCAGCAAGGCCCTGCTGCCCAATCTCCATCTGTCAACAGGGGCGTGAGGTCCCAGGAAGTGGCCAAAAGCTAGACAGATCCCCGTTCCTGACATCACAGCAGCCTCCAACACAAGGCTCCAAGACCTAGGCTCATGGACGAGATGGGAAGGCACAGGGAGAAGGGATAACCCTACACCCAGACCCCAGGCTGGACATGCTGACTGTCCTCTCCCCTCCAGCCTTTGGCCTTGGCTTTTCTAGCCTATTTACCTGCAGGCTGAGCCACTCTCTTCCCTTTCCCCAGCATCACTCCCCAAGGAAGAGCCAATGTTTTCCACCCATAATCCTTTCTGCCGACCCCTAGTTCCCTCTGCTCAGCCAAGCTTGTTATCAGCTTTCAGGGCCATGGTTCACATTAGAATAAAAGGTAGTAATTAGAACACTCTGGCTCCTGGCTCTTCTGTTGAGATCCAGTTCATTTATCCTAAAGAGGTAACTAAAGACGCTAAATCCAGTCACTGAGGTGGGAGAACGCAGCCCAAGTAACCCACAGAGATGCCTGCGGGGCCAGGCAGGCCTGGGGGGGGGCTTGTAGTCTTTGGACACAGACATACTTGATTACATGTTTAACACACACGAACACTCTACTTCCAAAAAGAAATAGGCTCTTGCCTAGTTTAAGCACAAGCTCTTCTTGGTACAGCTTTCATTTTCCTATGTCCCCAATTTCATTTCTATACTAAGAACAGTGTGAATGTGATGACAGATGGCAACCGACATAGGGCCTCCGTGTCAGGATGGACAGGAAGTAGGGGACTGTGGAGAACTGGGTGCCCATGCCTTACCTAAGGGGCTGACTGCTACTCAGCTCTATCTGGTTGCTGCCAGGAGGAAGCACAGCCCCCGTTGCCAGATGTTATCTTTTTAAGAGGAGCCAGAAATCAAGAACTGCAGTGAAATCACCCCATTTTTAAGTTTAAAGTCTTGCTGTGGGTCAACAAGGCCCAATGAGGACACTACTCTGTAGTTCTGTTCTAGAGCAACATGCTTGAGAGGAGAGAGGCCAGATGGTGGAGGGTCTGGCCCCGGGCCCCGAGTCAAGGGTGCAGCTGGATGCCAACCTGGGTCTCCGACACCTCCAGCCATGCATTCCTTTTCTGCACTGCCTCTGGCTGTTTCCAGCATGAGGCTAAAAGCTCTGGAGACCATCTCCAGGACCCCTGGTGTTCCACATGGCTCTGGGCCCAGGGAAGTGGGCTTCTGCATTTCCAGGCTGGAGCAGCAGACCACCTCCTTTGCTATCCCTCCCCTCCCTCAGTCCACACCCAAGACATCATCCTGTCTTTCATGTTCATCCACTTCTTGCCCTCACCACCACAGAACCATGGTGAGCTCGATTTGAGGGGCAACTCACTTCCGATTTTCCTAGACCTGCTGTGCCTGCCACAGCTGTTCACCAGGCACCTCCAGGGAGCCTGCCCCTAGCTCGAGGCCTAACTCGAGGATTCTCAGCCCCTTCCATTTCTTGTCTTTGGGTATTTACATGACTTACTCTGGCAACAGGAAATCAACCATGACCATCCTTTAGTTCCATCCTTTAGTTTAGATGCCACCTCATCCAGGAAGCCTTCCCCACCAATTCGGCACTCAGGCACTTCACTGCTCACTGCCTGTCCCACTAACCACGGTCACCCATAGCCTCAACATGCAGGCAAGAGGGAATCCCGAGTGTCGGCGAGACAGTCCCTTCCAAGAAACATGTGCCCCAGATGCACT