Transcript asmbl_113182

Sequence
Transcript Sequence for observation asmbl_113182 of TGE0002140:
GCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGCAGCTGCCGCCGCCGCCACCGAGCCGCCGCTGTGCTCACTGATCCGCCTCCAGGGCCACCGCCATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTCCCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAAGCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCCCAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAGTCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCACCAAGAGCCTCTTCCTTGGCCAGAAGCTGAACCTTATTCACAGTGAAATCAGTAATTTAGCCGGCTTTGAGGTGGAGGCCATAATCAATCCTACCAATGCTGACATTGACCTTAAAGATGACCTAGGAAACACGCTGGAGAAGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGCTGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGGGGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGAAGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCAGCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTCGTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAGGCTGAGCAATGACAGAACCAGCTGCACCATGTACCCCACCTTCAGTTTAAAAGAAAAAAAAAATCCCCTTCACTCCTACTGGGAGGTGGGACCCCTTTCATTTTCAGTTTTGCTCATCTAGGGAAAATAAGGCTTTGGTTTCCAGTTTAATTGTTTTTGACCTTCTAAAATGTTTTTATGTTAGCACTGATAGTTGGCATTACTGTTGTTAAGCACTGTGTTCCAGACCGTGTCTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTTTAATGAAACCCTGATTGACGCACAGCAGTGGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTGTAAGCGTGTGTTGTGGTGCTTTATTGTACATCCTCCAGTGGCGTTCTTTTTACTCTAATGTTCTTTTGGTTTCCCCCCTCAGAAGAATCATGAATTTGCAACAGACCTAATTTTTGGTTACTTTTTGTCTTATTGATGGATTTGAAAATGAAAGATTTAATAAGGCAAAGCAGAATCTGTTGTCCTTAATTATATTTGCAATTTGGAATTTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTT