Transcript asmbl_113180

Sequence
Transcript Sequence for observation asmbl_113180 of TGE0057571:
GCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGCAGCTGCCGCCGCCGCCACCGAGCCGCCGCTGTGCTCACTGATCCGCCTCCAGGGCCACCGCCATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTCCCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAAGCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCCCAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAGTCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCACCAAGAGCCTCTTCCTTGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACAGTGATGCTGTCGTTCACCCGACAAACACTGACTTCTACATCGGTGGTGAAGTAGGAAACACGCTGGAGAAGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGCTGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGGGGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGAAGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCAGCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTCGTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAGGCTGAGCAATGACAGAACCAGCTGCACCATGTACCCCACCTTCAGTTTAAAAGAAAAAAAAAATCCCCTTCACTCCTACTGGGAGGTGGGACCCCTTTCATTTTCAGTTTTGCTCATCTAGGGAAAATAAGGCTTTGGTTTCCAGTTTAATTGTTTTTGACCTTCTAAAATGTTTTTATGTTAGCACTGATAGTTGGCATTACTGTTGTTAAGCACTGTGTTCCAGACCGTGTCTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTTTAATGAAACCCTGATTGACGCACAGCAGTGGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTGTAAGCGTGTGTTGTGGTGCTTTATTGTACATCCTCCAGTGGCGTTCTTTTTACTCTAATGTTCTTTTGGTTTCCCCCCTCAGAAGAATCATGAATTTGCAACAGACCTAATTTTTGGTTACTTTTTGTCTTATTGATGGATTTGAAAATGAAAGATTTAATAAGGCAAAGCAGAATCTGTTGTCCTTAATTATATTTGCAATTTGGAATTTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTT