Transcript asmbl_113172

Sequence
Transcript Sequence for observation asmbl_113172 of TGE0058253:
CCCCGCCCTTGGCCCAGCCGCTCGCTCGGCTCCGCTCCCTGGCTCGGCTCCCTGCCTCCGCGTCGCAGCCCCCGCCGTAGCCGCCTCCGAGCCCGCCGCCACATCCTCTGAGCAGAAGATGGCTGTGCCACCCACGTATGCCGATCTTGGCAAATCTGCCAGGGATGTCTTCACCAAGGGCTATGGATTTGGCTTAATAAAGCTTGATTTGAAAACAAAATCTGAGAATGGATTGGAATTTACAAGCTCAGGCTCAGCCAACACTGAGACCACCAAAGTGACGGGCAGTCTGGAAACCAAGTACAGATGGACTGAGTACGGCCTGACGTTTACAGAGAAATGGAATACCGACAATACACTAGGCACCGAGATTACTGTGGAAGATCAGCTTGCACGTGGACTGAAGCTGACCTTCGATTCATCCTTCTCACCTAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGCGGGAGCACATTAACCTGGGCTGCGACATGGATTTCGACATTGCTGGGCCTTCCATCCGGGGTGCTCTGGTGCTAGGTTACGAGGGCTGGCTGGCCGGCTACCAGATGAATTTTGAGACTGCAAAATCCCGAGTGACCCAGAGCAACTTTGCAGTTGGCTACAAGACTGATGAATTCCAGCTTCACACTAATGTGAATGACGGGACAGAGTTTGGCGGCTCCATTTACCAGAAAGTGAACAAGAAGTTGGAGACCGCTGTCAATCTTGCCTGGACAGCAGGAAACAGTAACACGCGCTTCGGAATAGCAGCCAAGTATCAGATTGACCCTGACGCCTGCTTCTCGGCTAAAGTGAACAACTCCAGCCTGATAGGTTTAGGATACACTCAGACTCTAAAGCCAGGTATTAAACTGACACTGTCAGCTCTTCTGGATGGCAAGAACGTCAATGCTGGTGGCCACAAGCTTGGTCTAGGACTGGAATTTCAAGCATAAATGAATACTGTACAATTGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTATCTTTTAATGTTGTATGTCTGGGATGCAAGTATTGCTAAATATGTTAGCCCTCCAGGTTAAAGTTGATTCAGCTTTAAGATGTTACCCTTCCAGAGGTACAGAAGAAACCTATTTCCAAAAAAGGTCCTTTCAGTGGTAGACTCGGGGAGAACTTGGTGGCCCCTTTGAGATGCCAGGTTTCTTTTTTATCTAGAAATGGCTGCAAGTGGAAGCGGATAATATGTAGGCACTTTGTAAATTCATATTGAGTAAATGAATGAAATTGTGATTTCCTGAGAATCGAACCTTGGTTCCCTAACCCTAATTGATGAGAGGCTCGCTGCTTGATGGTGTGTACAAACTCACCTGAATGGGACTTTTTTAGACAGATCTTCATGACCTGTTCCCACCCCAGTTCATCATCATCTCTTTTACACCAAAAGGTCTGCAGGGTGTGGTAACTGTTTCTTTTGTGCCATTTTGGGGTGGAGAAGGTGGATGTGATGAAGCCAATAATTCAGGACTTATTCCTTCTTGTGTTGTGTTTTTTTTTGGCCCTTGCACCAGAGTATGAAATAGCTTCCAGGAGCTCCAGCTATAAGCTTGGAAGTGTCTGTGTGATTGTAATCACATGGTGACAACACTCAGAATCTAAATTGGACTTCTGTTGTATTCTCACCACTCAATTTGTTTTTTAGCAGTTTAATGGGTACATTTTAGAGTCTTCCATTTTGTTGGAATTAGATCCTCCCCTTCAAATGCTGTAATTAACAACACTTAAAAAACTTGAATAAAATATTGAAACCTC