Transcript asmbl_112346

Sequence
Transcript Sequence for observation asmbl_112346 of TGE0059536:
CGCGTAGGTCCCCGCCCCCAGAGTCTGGCTTTCCGCGGCTGCCCGCCTCGCGCGTCTTCCCTGCCCGGGTCTCCTCGCTGTCGCCGCCGCTGCCACACCATGGCCTTCGTCACCAGGCAGTTCATGCGTTCCGTGTCCTCCTCGTCCACCGCCTCGGCCTCGGCCAAGAAGATAATCGTCAAGCACGTGACGGTCATCGGCGGCGGGCTGATGGGCGCCGGCATTGCCCAGGTTGCTGCAGCAACTGGTCACACAGTAGTGTTGGTAGACCAGACAGAGGACATCCTGGCAAAATCCAAAAAGGGAATTGAGGAAAGCCTTAGGAAAGTGGCAAAGAAGAAGTTTGCAGAAAACCTTAAGGCCGGCGATGAATTTGTGGAGAAGACCCTGAGCACCATAGCGACCAGCACGGATGCAGCCTCCGTTGTCCACAGCACAGACTTGGTGGTGGAAGCCATCGTGGAGAATCTGAAGGTGAAAAACGAGCTCTTCAAAAGGCTGGACAAGTTTGCTGCTGAACATACAATCTTTGCCAGCAACACTTCCTCCTTGCAGATTACAAGCATAGCTAATGCCACCACCAGACAAGACCGATTCGCTGGCCTCCATTTCTTCAACCCAGTGCCTGTCATGAAACTTGTGGAGGTCATTAAAACACCAATGACCAGCCAGAAGACATTTGAATCTTTGGTAGACTTTAGCAAAGCCCTAGGAAAGCATCCTGTTTCTTGCAAGGACACTCCTGGGTTTATTGTGAACCGCCTCCTGGTTCCATACCTCATGGAAGCAATCAGGCTGTATGAACGAGGTGACGCATCCAAAGAAGACATTGACACTGCTATGAAATTAGGAGCCGGTTACCCCATGGGCCCATTTGAGCTTCTAGATTATGTCGGACTGGATACTACGAAGTTCATCGTGGATGGGTGGCATGAAATGGATGCAGAGAACCCATTACATCAGCCCAGCCCATCCTTAAATAAGCTGGTAGCAGAGAACAAGTTCGGCAAGAAGACTGGAGAAGGATTTTACAAATACAAGTGATGTGCAGCTTCTCCGGCTCTGAGAAGAACACCTGAGAGCGCTTTCCAGCCAGTGCCCCGAGTGCCTGTGGGAATGCTCTTTGGTCAGACATTCCCTCACACAGTACAGTTTAATAAATGTGCATTTTGATTGTAATCTATCGAAGTGATTATTACACCAGTTACAGCAGTAATAGATTCTCCATTAAGAAATAATTCCCTTTTTTAGTCTGTTCATTTCTGTGTATTTTCTAAACAGCTTTACACCCTTGGTGCCTTGGAGCAAACATGTTTTTTGAACCTTGTCATTTTTGTGAAGAATTGCCTAGATTCCTTCTCTCATCAACGGGAAAGTACTTCCTCTGAGAGTGCGAGTGCACCATGCTCACTGTTGCTGCGTGGGAGAGTCACAAGCCACTGGCAAGCAAGTGGTATAGTCTGTGAAGCACTGCAGCGAGCAGCACCTGGATCTTGCCTTTATAAGAACATTTTACTACCTGCAGCTTTGAGTCTTGCCCTACATTTTGGGCATGACATAAGATGTGTCTTTATTCAGCTCGTCGTGAAGATGCTGCTGCTGAATGGGTCAGCATATCTCTGTTTGCATGGTTTGCAGGAGGTCGGTTTTCATGGTCATTCAGTTCCACAGATCTGAATGATTACTGTCTGTCTGTGTCTTTTTTCCATGAGAAATCACTGTTGCAAATTGCCTATAAATTGACTCTACTAAAATAACAATGTTTCAGTCTGAAAATTTGAATTGAAAAAAATGTATAATATAAAATTGTAATACACTCAAATGATTATAAAAGTAAAAGTTGGTAATTTAGGCAGA