Transcript asmbl_11034

Sequence
Transcript Sequence for observation asmbl_11034 of TGE0059535:
TTTCTGCGACTTGTGTTGGGACTGGTGAGTGTGGGCAGTGCGGCCCCTGCGGAGTGAGGCGCGGCGCGCCCTTCTTGCCTGTTGCCTCTTCCTCCTCCTGTCCGGGGCCCGCCCGCGCTCGGGTGGGGGTGCTGTGATGCGTGAGGCAGCCGGGGGAGGCCCGGAGTCCGAGACTGCTTGAGCGCTGCGCACACCCCTCTCGTGGGCCCCCCACCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCACTGTAAATGACCTCCCTGTTGGCCGCTCTGTGGATGAGACTTTGAGACTAGTT