Transcript asmbl_11033

Sequence
Transcript Sequence for observation asmbl_11033 of TGE0059535:
TTTCTGCGACTTGTGTTGGGACTGGTGAGTGTGGGCAGTGCGGCCCCTGCGGAGTGAGGCGCGGCGCGCCCTTCTTGCCTGTTGCCTCTTCCTCCTCCTGTCCGGGGCCCGCCCGCGCTCGGGTGGGGGTGCTGTGATGCGTGAGGCAGCCGGGGGAGGCCCGGAGTCCGAGACTGCTTGAGCGCTGCGCACACCCCTCTCGTGGGCCCCCCACGTAGGTGCGGGAACCTGGTTGAACCCCAAGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCACTGTAAATGACCTCCCTGTTGGCCGCTCTGTGGATGAGACTTTGAGACTAGTT