Transcript asmbl_11032

Sequence
Transcript Sequence for observation asmbl_11032 of TGE0056652:
CATCCCCCTCCTCTCTCTCCTCCTCCGGCACCCCCGTCCGTTCCGACTCTCGCGAGATCCCTACTGGCTATAAAGGCAGCGCCCCGGAGAGCTCTTGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCACTGTAAATGACCTCCCTGTTGGCCGCTCTGTGGATGAGACTTTGAGACTAGTTCAGGCCTTCCAGTTCACTGACAAACATGGGGAAGTGTGCCCAGCTGGCTGGAAACCTGGCAGTGATACCATCAAGCCTGATGTCCAAAAGAGCAAAGAATATTTCTCCAAGCAGAAGTGAGCGCTGGGCTGTTTTAGTGCCAGGCTGCGGTGGGCAGCCATGAGAACAAAACCTCTTCTGTATTTTTTTTTTCCATTAGTAAAACACAAGACTTCAGATTCAGCCGAATTGTGGTGTCTTACAAGGCAGGCCTTTCCTACAGGGGGTGGAGAGACCAGCCTTTCTTCCTTTGGTAGGAATGGCCTGAGTTGGCGTTGTGGGCAGGCTACTGGTTTGTATGATGTATTAGTAGAGCAACCCATTAATCTTTTGTAGTTTGTATTAAACTTGAACTGAGA