Transcript asmbl_10868

Sequence
Transcript Sequence for observation asmbl_10868 of TGE0059533:
CTGGCCTATATAAGACGAGGACAAAGGCGGCGCGCCGCCTGTGTCATCCGCCATTTTGTGAGAAGCAAGGTGGCCTCCACGTTTCCTGAGCGTCTTCTTCGCTTTTGCCTCGACCGCCCCTTGACCACAGACATGTCTCGGGATCGGTTCCGGAGTCGTGGCGGTGGCGGTGGTGGCTTCCACAGGCGTGGAGGAGGCGGCGGCCGCGGCGGCCTCCACGACTTCCGTTCTCCGCCGCCCGGCATGGGCCTCAATCAGAATCGCGGCCCCATGGGTCCTGGCCCGGGCCAGAGCGGCCCTAAGCCTCCGATCCCGCCACCGCCTCCACACCAACAGCAGCAACAGCCACCACCGCAGCAGCCACCGCCGCAGCAGCCGCCACCGCATCAGCCGCCGCCGCATCCACAGCCGCATCAGCAGCAGCAGCCGCCGCCACCGCCGCAGGACTCTTCCAAGCCCGTCGTTGCTCAGGGACCCGGCCCCGCTCCCGGAGTAGGCAGCGCACCACCAGCCTCCAGCTCGGCCCCGCCCGCCACTCCACCAACCTCGGGGGCCCCGCCAGGGTCCGGGCCAGGCCCGACTCCGACCCCGCCGCCTGCAGTCACCTCGGCCCCTCCCGGGGCGCCGCCACCCACCCCGCCAAGCAGCGGGGTCCCTACCACACCTCCTCAGGCCGGAGGCCCGCCGCCTCCGCCCGCGGCAGTCCCGGGCCCGGGTCCAGGGCCTAAGCAGGGCCCAGGTCCGGGTGGTCCCAAAGGCGGCAAAATGCCTGGCGGGCCGAAGCCAGGTGGCGGCCCGGGCCTAAGTACGCCTGGCGGCCACCCCAAGCCGCCGCATCGAGGCGGCGGGGAGCCCCGCGGGGGCCGCCAGCACCACCCGCCCTACCACCAGCAGCATCACCAGGGGCCCCCGCCCGGCGGGCCCGGCGGCCGCAGCGAGGAGAAGATCTCGGACTCGGAGGGGTTTAAAGCCAATTTGTCTCTCTTGAGGAGGCCTGGAGAGAAAACTTACACACAGCGATGTCGGTTGTTTGTTGGGAATCTACCTGCTGATATCACGGAGGATGAATTCAAAAGACTATTTGCTAAATATGGAGAACCAGGAGAAGTTTTTATCAACAAAGGCAAAGGATTCGGATTTATTAAGCTTGAATCTAGAGCTTTGGCTGAAATTGCCAAAGCCGAACTGGATGATACACCCATGAGAGGTAGACAGCTTCGAGTTCGCTTTGCCACACATGCTGCTGCCCTTTCTGTTCGTAATCTTTCACCTTATGTTTCCAATGAACTGTTGGAAGAAGCCTTTAGCCAATTTGGTCCTATTGAAAGGGCTGTTGTAATAGTGGATGATCGTGGAAGATCTACAGGGAAAGGCATTGTTGAATTTGCTTCTAAGCCAGCAGCAAGAAAGGCATTTGAACGATGCAGTGAAGGTGTTTTCTTACTGACGACAACTCCTCGTCCAGTCATTGTGGAACCACTTGAACAACTAGATGATGAAGATGGTCTTCCTGAAAAACTTGCCCAGAAGAATCCAATGTATCAAAAGGAGAGAGAAACCCCTCCTCGTTTTGCCCAGCATGGCACGTTTGAGTACGAATATTCTCAGCGATGGAAGTCTTTGGATGAAATGGAAAAACAGCAAAGGGAACAAGTTGAAAAAAACATGAAAGATGCAAAAGACAAATTGGAAAGTGAAATGGAAGATGCCTATCATGAACATCAGGCAAATCTTTTGCGCCAAGATCTGATGAGACGACAGGAAGAATTAAGACGCATGGAAGAACTTCACAATCAAGAAATGCAGAAACGTAAAGAAATGCAATTGAGGCAAGAGGAGGAACGACGTAGAAGAGAGGAAGAGATGATGATTCGTCAACGTGAGATGGAAGAACAAATGAGGCGCCAAAGAGAGGAAAGTTACAGCCGAATGGGCTACATGGATCCACGGGAAAGAGACATGCGAATGGGTGGCGGAGGAGCAATGAACATGGGAGATCCCTATGGTTCAGGAGGCCAGAAATTTCCACCTCTAGGAGGTGGTGGTGGCATAGGTTATGAAGCTAATCCTGGCGTTCCACCAGCAACCATGAGTGGTTCCATGATGGGAAGTGACATGGTAAGAATGATTGATGTTGGCTGATATTGGAGTGCTCATTCACATGAAGTGGATAGATACTTCTCAAGACATCACACAGCGTGAGTCAATCAAGGAGGGAAGCCACAAGCAGACTGACAACGTTTCTAGGATCAGGTGAGCTGTGTCCAGAAAACCAACGAGAAGGAGTGGAAGGAGGAATGAACGTTTCATTCTCGTTAATAAAGGCATTATCCTAA