Transcript asmbl_107383

Sequence
Transcript Sequence for observation asmbl_107383 of TGE0059532:
GTGGCCCGTGGCCTAGCTCGTCAAGTTGCCGTGGCGCGGAGAACTCTGCAAAACAAGAGGCTGAGGATTGCGTTAGAGATAAACCAGTTCACGCCGGAGCCCCGTGAGGGAAGCGTCTCCGTTGGGTCCGGCCGCTCTGCGGGACTCTGAGGAAAAGCTCGCACCAGGTGGACGCGGATCTGTCAACATGGGTAAAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTGCAGACCTGCCGGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAATTCTCCAAGAAGTGTTCGGAGAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTTGAAGATATGGCAAAAAGTGACAAAGCTCGCTATGACAGGGAGATGAAAAATTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGA