Transcript asmbl_107102

Sequence
Transcript Sequence for observation asmbl_107102 of TGE0001989:
GGCAGCCATTGGTGGGATGAGCAATCCGAGTTCCCGGATGAGGGAACATTCTGCAGTATAAAGGGAGCAGGGAAGGCGGGAGACAGCGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTAGCCTTTTCTCTGCCTTGCTTGCTTGAGCTTCAGCGGAATTCGAAATGGCTGGCGGTAAGGCTGGAAAGGACTCCGGAAAGGCCAAGACAAAGGCGGTTTCCCGCTCGCAGAGAGCCGGCTTGCAGTTCCCAGTGGGCCGTATTCATCGACACCTAAAATCTAGGACGACCAGTCATGGACGTGTGGGCGCGACTGCCGCTGTGTACAGCGCAGCCATCCTGGAGTACCTCACCGCAGAGGTACTTGAACTGGCAGGAAATGCATCAAAAGACTTAAAGGTAAAGCGTATTACCCCTCGTCACTTGCAACTTGCTATTCGTGGAGATGAAGAATTGGATTCTCTCATCAAGGCTACAATTGCTGGTGGTGGTGTCATTCCACACATCCACAAATCTCTGATTGGGAAGAAAGGACAACAGAAGACTGTCTAAAGGATGCCTGGATTCCTTGTTATCTCAGGACTCTAAATACTCTAACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTTTTGTAATTCTATTTGAGCAAGTTGGAAGTTTAATTAGCTTTCCAACCAACCAAATTTCTGCATTCGAGTCTTAACCATATTTAAGTGTTACTGTGGCTTCAAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTGAGTTGACTGTTTTTAAAAAACTGTTTGGATTTTAATTGTGATGCAGAAGTTATAGTAACAAACATTTGGTTTTGTACAGACATTATTTCCACTCTGGTGGATAAGTTCAATAAAGGTCATATCCCAAACT