Transcript asmbl_107089

Sequence
Transcript Sequence for observation asmbl_107089 of TGE0059531:
AGACTCACAGTCTGCTGGTGGGCAGAGAAGACAGAAACGACATGAGCACAGCAGGAAAAGAAAGTTGTCTGACAGAAGTTTGATGAGAGGAATTTGACTCAGAAGACTGAAATATCCTTTAACCTTACTATAAAATATCTTACAAAATACTCATTGATTTCACAGCATTAGAATCATCAAGGTTAAGCAAGACATCAACATGCAAATTCTGATTAAAAGGGGTCCATTATGATACAATTCAGGGAATTTCCACAAAAATCCTATGGAACAGTATCTTCCCCATTTAAAAGTTAATATGGTTTTACAGAAAATCAATGATACAATTTGAATAATAATACAATTTGAATCACTTAGCACTAGGAATACAGATATTTGGTTTTTTCTTCTATAAATTTGTACTTATTTGCTCAATGTGTTTACAGGTGCATGTGGTCATTCAATATAATCAATTGATTTTTTTAATTGTTTAATTACATAAACCTGTGCAACTATGTCCAGTCCTTTTTTTGTGTTAGGAGTGTACCACACTGTAAAATATCTCACTATGATAATTCAATTTAAAGGTTCTGAGGCTTCTCTCTGCATTGTGTGACAAACAGGCTCATATCAATAAGACTGGTTGATGGAGCTAGAGGACGTTATTCTAAGTAAAGTAACTCATGAATGGAACACCAAATATCCAATGTTCTCACTTAAAAGTGGTAGCTAAACTATGAGGACACAAAGGATGAGAATGATATAATGGACTTTGGGGACTGAGGGAAAAGGGCAGTAGGAGGAATAAGACATAAAAGACTACATATTGGGTTCAGTCTACACTGCTTGTGTGAGGGGTGCACCAAAATATCAGAAATCACCACTAAAGAACTTATCCGTGTAACCAAAAACCATCTGCACCCCAAAAACTATTGAAATTAAAAATTAATCAATGAATAAATTTTAAGATAAAAATAATGCATGTAATTTACCCAGCACAGGTCACAATGTGCCTGTCACATCATAAGCACCTCATAATAAGAATCTTCCTACTATTAGTACCTTCTGTCTAAGTATTCTGGTATTTATTTTGGCATTGACCATGTTGAACATCCTACAAAGTTGAAAATTTTGACAAATAAATAATGAAAATGAATTGGCAGAAAAATAAATCTCAATTGAATTTTTAAATTATATTTGCAATTATGTTGGTTCTTTCTAGAAAGGGCTCTGCGAATTATACATGCTTTACCACAACGAAGATGGGTTTTACAGTACACTGCCAAGCACTAGAAATATATGCTGAACTTTATTTTTAAGAACATCTATGGATAAGCTCTGCTAAACAGAAATCCAAGCACACTGTTTCTCCAGTTTTAAAATATACATGCGTGGGTCTGAGTGTATACACACACACACACGTGCACACACACACACCACCAACTCTAATCTCTATAATATTTGGCTCAAATCTAAGCTGAAAGAAGTCTCTACACATAAATTAGATTACAAAACAGGCTGCCAAAGCTAAGTTTCAAATGAGTAGGAAACAAGTAGCACACAGAAGTAGTGGAGAGAGAAAATTAAAAGAGGACAATAAGCAAATAGGGAGAGAAAGAAATGTCATTGTGCGCAGGAAGGTAAATGTATAATTGCTCTTATAGAGTCAGATCCTTTTGGCCTAAGCAGAAAATTGAGCAATAAAGCAGTGTATTTTATGTAGACAGACACTGACTCTGTCAGCAAAATAAAGGTGACTTCTAACTTCATATATCAGCTAATAGTTGTGGGTAGACGAGCATTTTCAGGACGGCATTAGGAAATACCAGGAATAAACACCTTCAGAGAAAAAACAACAACATAAGAATGGCCTAAATAAATATATTCCATTTTTCTCAATGTCTTATTATACTTTGTTTATCTTTCCTTATGTTATTGCTTTTTAAAAGATACTTTTATTCTCTTTATAAACCAGAGTACTTCATTTCCATGGAGCACTTGTTAGGTACCAGACATGGGACGCAATATTACATGTACAAAGATGAAAAGACACAACTTATGACTTCAAGAGTGGGAAAACACTGTCACCATCTCTCTGTTTGATTTTCTAGGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGGTAAAGAAACCCTTTTCCATTGAGGATGTGGAGGTTGCACCTCCTAAGGCTTATGAAGTTCGCATTAAGATGGTGGCTGTAGGAATCTGTCACACAGATGACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAATGCAGAGTTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCTCGGGGGACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGGGGGAAGCCCATTCACCACTTCCTTGGCACCAGCACCTTCTCCCAGTACACGGTGGTGGATGAGAATGCAGTGGCCAAAATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCTCATTGGCTGTGGATTCTCGACTGGTTATGGGTCTGCAGTTAACGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCGGCTTGACACCATGGTATGTACCATGACATGCCCTGAGATTTCTGCCTCTGCAACCTGGAAGATGCATTTAGGCAGCAAAATATATGTTTTATGTATAAAGGATATTTTTAATGATGAATGGAAATTTCCCATCATCTGTTTGTTATGTGGCTTGTTTAATTTTTGTTATGAGAAATCTTCTCTTCCATCAATTACCCAAACCTGTCTCAAGTCATATTTCCTCTAGAGGAAAAGAAAAGGGTTTGTTTTTCTTAACTGAGC