Transcript asmbl_107088

Sequence
Transcript Sequence for observation asmbl_107088 of TGE0056673:
AGACTCACAGTCTGCTGGTGGGCAGAGAAGACAGAAACGACATGAGCACAGCAGGAAAAGAAAGTTGTCTGACAGAAGTTTGATGAGAGGAATTTGACTCAGAAGACTGAAATATCCTTTAACCTTACTATAAAATATCTTACAAAATACTCATTGATTTCACAGCATTAGAATCATCAAGGTTAAGCAAGACATCAACATGCAAATTCTGATTAAAAGGGGTCCATTATGATACAATTCAGGGAATTTCCACAAAAATCCTATGGAACAGTATCTTCCCCATTTAAAAGTTAATATGGTTTTACAGAAAATCAATGATACAATTTGAATAATAATACAATTTGAATCACTTAGCACTAGGAATACAGATATTTGGTTTTTTCTTCTATAAATTTGTACTTATTTGCTCAATGTGTTTACAGGTGCATGTGGTCATTCAATATAATCAATTGATTTTTTTAATTGTTTAATTACATAAACCTGTGCAACTATGTCCAGTCCTTTTTTTGTGTTAGGAGTGTACCACACTGTAAAATATCTCACTATGATAATTCAATTTAAAGGTTCTGAGGCTTCTCTCTGCATTGTGTGACAAACAGGCTCATATCAATAAGACTGGTTGATGGAGCTAGAGGACGTTATTCTAAGTAAAGTAACTCATGAATGGAACACCAAATATCCAATGTTCTCACTTAAAAGTGGTAGCTAAACTATGAGGACACAAAGGATGAGAATGATATAATGGACTTTGGGGACTGAGGGAAAAGGGCAGTAGGAGGAATAAGACATAAAAGACTACATATTGGGTTCAGTCTACACTGCTTGTGTGAGGGGTGCACCAAAATATCAGAAATCACCACTAAAGAACTTATCCGTGTAACCAAAAACCATCTGCACCCCAAAAACTATTGAAATTAAAAATTAATCAATGAATAAATTTTAAGATAAAAATAATGCATGTAATTTACCCAGCACAGGTCACAATGTGCCTGTCACATCATAAGCACCTCATAATAAGAATCTTCCTACTATTAGTACCTTCTGTCTAAGTATTCTGGTATTTATTTTGGCATTGACCATGTTGAACATCCTACAAAGTTGAAAATTTTGACAAATAAATAATGAAAATGAATTGGCAGAAAAATAAATCTCAATTGAATTTTTAAATTATATTTGCAATTATGTTGGTTCTTTCTAGAAAGGGCTCTGCGAATTATACATGCTTTACCACAACGAAGATGGGTTTTACAGTACACTGCCAAGCACTAGAAATATATGCTGAACTTTATTTTTAAGAACATCTATGGATAAGCTCTGCTAAACAGAAATCCAAGCACACTGTTTCTCCAGTTTTAAAATATACATGCGTGGGTCTGAGTGTATACACACACACACACGTGCACACACACACACCACCAACTCTAATCTCTATAATATTTGGCTCAAATCTAAGCTGAAAGAAGTCTCTACACATAAATTAGATTACAAAACAGGCTGCCAAAGCTAAGTTTCAAATGAGTAGGAAACAAGTAGCACACAGAAGTAGTGGAGAGAGAAAATTAAAAGAGGACAATAAGCAAATAGGGAGAGAAAGAAATGTCATTGTGCGCAGGAAGGTAAATGTATAATTGCTCTTATAGAGTCAGATCCTTTTGGCCTAAGCAGAAAATTGAGCAATAAAGCAGTGTATTTTATGTAGACAGACACTGACTCTGTCAGCAAAATAAAGGTGACTTCTAACTTCATATATCAGCTAATAGTTGTGGGTAGACGAGCATTTTCAGGACGGCATTAGGAAATACCAGGAATAAACACCTTCAGAGAAAAAACAACAACATAAGAATGGCCTAAATAAATATATTCCATTTTTCTCAATGTCTTATTATACTTTGTTTATCTTTCCTTATGTTATTGCTTTTTAAAAGATACTTTTATTCTCTTTATAAACCAGAGTACTTCATTTCCATGGAGCACTTGTTAGGTACCAGACATGGGACGCAATATTACATGTACAAAGATGAAAAGACACAACTTATGACTTCAAGAGTGGGAAAACACTGTCACCATCTCTCTGTTTGATTTTCTAGGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGGTAAAGAAACCCTTTTCCATTGAGGATGTGGAGGTTGCACCTCCTAAGGCTTATGAAGTTCGCATTAAGATGGTGGCTGTAGGAATCTGTCACACAGATGACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAATGCAGAGTTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCTCGGGGGACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGGGGGAAGCCCATTCACCACTTCCTTGGCACCAGCACCTTCTCCCAGTACACGGTGGTGGATGAGAATGCAGTGGCCAAAATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCTCATTGGCTGTGGATTCTCGACTGGTTATGGGTCTGCAGTTAACGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCACAAGCGTCATCGTAGGGGTACCTCCTGCTTCCCAGAACCTCTCAATAAACCCTATGCTGCTACTGACTGGACGCACCTGGAAGGGGGCTGTTTATGGTGGCTTTAAGAGTAAAGAAGGTATCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAGTTTTCACTGGATGCGTTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTTGACCTGCTTCACTCTGGGAAAAGTATCCGTACCGTCCTGACGTTTTGAGGCAATAGAGATGCCTTCCCCTGTAGCAGTCTTCAGCCTCCTCTACCCTACAAGATCTGGAGCAACAGCTAGGAAATATCATTAATTCAGCTCTTCAGAGATGTTATCAATAAATTACACATGGGGGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTTTCAGGAAAATTTAAAATTCAAGTGAGAAGTAAATAAAGTGTTGAACATCAGCTGGGGAATTGAAGCCAACAAACCTTCCTTCTTAACCATTCTACTGTGTCACCTTTGCCATTGAGGAAAAATATTCCTGTGACTTCTTGCATTTTTGGTATCTTCATAATCTTTAGTCATCGAATCCCAGTGGAGGGGACCCTTTTACTTGCCCTGAACATACACATGCTGGGCCATTGTGATTGAAGTCTTCTAACTCTGTCTCAGTTTTCACTGTCGACATTTTCCTTTTTCTAATAAAAATGTACCAAATCCCTGGGGTAAAAGCTAGGGTAAGGTAAAGGATAGACTCACATTTACAAGTAGTGAAGGTCCAAGAGTTCTAAATACAGGAAATTTCTTAGGAACTCAAATAAAATGCCCCACATTTTACTACAGTAAATGGCAGTGTTTTTATGACTTTTATACTATTTCTTTATGGTCGATATACAATTGATTTTTTAAAATAATAGCAGATTTCTTGCTTCATATGACAAAGCCTCAATTACTAATTGTAAAAACTGAACTATTCCCAGAATCATGTTCAAAAAATCTGTAATTTTTGCTGATGAAAGTGCTTCATTGACTAAACAGTATTAGTTTGTGGCTATAAATGATTATTTAGATGATGACTGAAAATGTGTATAAAGTAATTAAAAGTAATATGGTGGCTTTAAGTGTAGAGATGGGATGGCAAATGCTGTGAATGCAGAATGTAAAATTGGTAACTAAGAAATGGCACAAACACCTTAAGCAATATATTTTCCTAGTAGATATATATATACACATACATATATACACATATACAAATGTATATTTTTGCAAAATTGTTTTCAATCTAGAACTTTTCTATTAACTACCATGTCTTAAAATCAAGTCTATAATCCTAGCATTAGTTTAATATTTTGAATATGTAAAGACCTGTGTTAATGCTTTGTTAATGCTTTTCCCACTCTCATTTGTTAATGCTTTCCCACTCTCAGGGGAAGGATTTGCATTTTGAGCTTTATCTCTAAATGTGACATGCAAAGATTATTCCTGGTAAAGGAGGTAGCTGTCTCCAAAAATGCTATTGTTGCAATATCTACATTCTATTTCATATTATGAAAGACCTTAGACATAAAGTAAAATAGTTTATCATTTACTGTGTGATCTTCAGTAAGTCTCTCAGGCTCTCTGAGCTTGTTCATCCTTTGTTTTGAAAAAATTACTCAACCAATCCATTACAGCTTAACCAAGATTAAATGGGATGATGTTAATGAAAGAGCTTCGCCAATTAAGAAGGGCCATGTAAATGTGGGTAACCTGATTGTTTTGTCAAAAATGCTAAAGCGGGGTGGGGGGTGGCGCAGTGGCTTATCCCTGTAATCCCAGCACTTTGGGA