Transcript asmbl_106994

Sequence
Transcript Sequence for observation asmbl_106994 of TGE0001979:
CGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCGGGAGAGAGCGGGAGTGTGCGCCGCGCGAGAGTGGGAGGCGAAGGGGGCAGGCCAGGGAGAGGCGCAGGAGCCTTTGCAGCCACGCGCGCGCCTTCCCTGTCTTGTGTGCTTCGCGAGGTAGAGCGGGCGCGCGGCAGCGGCGGGGATTACTTTGCTGCTAGTTTCGGTTCGCGGCAGCGGCGGGTGTAGTCTCGGCGGCAGCGGCGGAGACACTAGCACTATGTCGGAGGAGCAGTTCGGCGGGGACGGGGCGGCGGCAGCGGCAACGGCGGCGGTAGGCGGCTCGGCGGGCGAGCAGGAGGGAGCCATGGTGGCGGCGACACAGGGGGCAGCGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGGAACCGCGTCTGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATTGACGCCAGTAAGAACGAGGAGGATGAAGGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGCGACGGCACAGCGGGAAGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGAGAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTACCTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGTGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAACCAGCAGAGTGGTTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAAATTGTCATGGATTCAAGTTATTAAAAGCATAAGTTTGGAAGACAGGCTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGATTTTTAGAGCTGTGGTGGACTTCATAGATGAATTCAAGTGTTGAGGGAGGATTAAAGAAATATATACCGTGTTTATGTGTGTGTGCTTATTTGTTTGAATGATTTTATTTTCCATTTCTCAAAGGTTTTATTTTTTTGGTTAGGGCCTTAAAATTTCAGGACTGTGATTATTAGTATGTGTGCCTAAGGAACTTTTTGAGTCACTCTTAAGAAAGTGAAACTGAAGAGTCTAAGTGATAACTATAGGATTAAGTCAGAATTGTTTTTCCTGTCATTTGTTGGAAGCTTCTTGAGTTCTGTTATTAGCATTCAGGGAATTGATACCCATCAACTTGAATGGAAAATCGTTTGTAGGTATTACTTAAGTGAATGTTAAGAGTTCCACCCTGAGTGGTAATCTAAGGCTGTGCAGTCAGTTACTTCAGACTGCTCAGAATAGTTCATTAGAAAGGTAACAAATGAGAAATGTATTATTATACAGTTCTATAGTAGTGAAGTGATGGAATACCTTTCTTACTTTTGTGGAGTTACATCTGATGCTAAGAATTTGACCTCCAACTAAGCAAACATTTTAATGAGCAAAAGTTAGTGTTATTAAAGTTTTTTTATGATAGATCCAAATTGAGGACCTGTGTCCTGTTTTTATAAGATTGCAACCCAGCTATGCTCATTTGTTTATGTTTTGTATATGGCTGCTTTTGTGTTACAGTGGTAGAGTTTAGTAGTTAGGACAGAGACCTGCAAAGCAAAATAATTTACAGTCTGGCCCTTTACAGAAAAGTTTGCTGACTCATGGTCAAAATAAATGAAAATTTTTTGTGTTAGGGTTGTTAAGCTAGGGTTCTTTTTGGTATCATATGCTTATTTTATGTAAATCTCTCAATAAAAAATTATTTTTAAGAGACAGGGTCTCCCTCTGTCGTTCATGCTAGAGTACAGTGGCTCA