Transcript asmbl_106993

Sequence
Transcript Sequence for observation asmbl_106993 of TGE0001980:
CGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCGGGAGAGAGCGGGAGTGTGCGCCGCGCGAGAGTGGGAGGCGAAGGGGGCAGGCCAGGGAGAGGCGCAGGAGCCTTTGCAGCCACGCGCGCGCCTTCCCTGTCTTGTGTGCTTCGCGAGGTAGAGCGGGCGCGCGGCAGCGGCGGGGATTACTTTGCTGCTAGTTTCGGTTCGCGGCAGCGGCGGGTGTAGTCTCGGCGGCAGCGGCGGAGACACTAGCACTATGTCGGAGGAGCAGTTCGGCGGGGACGGGGCGGCGGCAGCGGCAACGGCGGCGGTAGGCGGCTCGGCGGGCGAGCAGGAGGGAGCCATGGTGGCGGCGACACAGGGGGCAGCGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGGAACCGCGTCTGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATTGACGCCAGTAAGAACGAGGAGGATGAAGGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGCGACGGCACAGCGGGAAGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGAGAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTACCTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGACCAGCAGAGTGGTTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTATGTTCTAAAAATAGTTTTTTTTTGTCATTTACAATAGTAGTTTTTATAATCTATATTGTTCATAAAACAATGCTTAATTTAAGAGTTTCACAGCACCCAGAAGTGCTTACCATATTATAACATAGTGACTTTCAAAGATATGTAACACAGGTGCTCTTAAGCTTTTGCCTTTTTGTCCTATTATTAACAAGTCAGTAAAGTTAACAGGTAAAGTACTGCTAATGGGTACAAATTAAGGAATTGCAGCAAAAAAGTATTGCCTACTAACTCTGACATTATACCTTGTTTGTACCCGCCAGCGGGAACTTCATTGCAGGCCCTGTGTCGCGCTGACTTCACGATTCTCACAGGCCCGCTCAATGCGGACAGGGTACGAGATGCTCACGCTCTCGAATGCTGCCGTTTGGTATGGTCTCTTCCAACATCCTGTATCAGCATTATAAAATAAAATGGATACTTCAAGCTTTGCCTTCACTTATTTCTTTGCTTTTTAAAAACTATTTGTAATGTAATTTTAATGCATTTTTTACAGGCCCAGTAATGGTTAAATACGTCAGCTTACTGAATAATTTTAACTATTTATTCTTCTAAGGATACAGCTTGTCTCTGGATTTTCCAGTCTTAATTTTATATTTTATTAATCTATTTTAATGCTTGCTTTTCCCATTTATAGACGTTGTAGCAGTAATTGCAAGAAGTTCTTGAGCTGAATTCCTGTTGTGACAACTTCCTATAATTACAGTAGATAACTTTTTCTTTTAGTCGTATATAACTTTTCTATAACTTGTGATGGACAAGAGATATGCTTATCCAATAAAATAAGCTTAAATATTAGATGCTCTTGGGTCAAAATGTCCTTTTACCAAATTGACCTTTTTATGAGTTCTTTGGGTAAATACTTTAAAGCTTTTTATATTTTAAAGAATACTTGTAAAAGCATATCACATCTTAAACCAGTGGTGCACATGTGGATTTACAGCTCATGGACTCTACTGTTCAGCTTTAATTTATAAAACATATCACACATTTAATGTTATACAGTATTTACATATAGTGGAACATAGGGATAACTCAGTTTTATGTAAATTTTTGTTAAGTGTTGTAGCCTGCCCAGAGTGACTTCTATTTTTTCTTCTTTGTCTCCAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAAATTGTCATGGATTCAAGTTATTAAAAGCATAAGTTTGGAAGACAGGCTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGATTTTTAGAGCTGTGGTGGACTTCATAGATGAATTCAAGTGTTGAGGGAGGATTAAAGAAATATATACCGTGTTTATGTGTGTGTGCTTATTTGTTTGAATGATTTTATTTTCCATTTCTCAAAGGTTTTATTTTTTTGGTTAGGGCCTTAAAATTTCAGGACTGTGATTATTAGTATGTGTGCCTAAGGAACTTTTTGAGTCACTCTTAAGAAAGTGAAACTGAAGAGTCTAAGTGATAACTATAGGATTAAGTCAGAATTGTTTTTCCTGTCATTTGTTGGAAGCTTCTTGAGTTCTGTTATTAGCATTCAGGGAATTGATACCCATCAACTTGAATGGAAAATCGTTTGTAGGTATTACTTAAGTGAATGTTAAGAGTTCCACCCTGAGTGGTAATCTAAGGCTGTGCAGTCAGTTACTTCAGACTGCTCAGAATAGTTCATTAGAAAGGTAACAAATGAGAAATGTATTATTATACAGTTCTATAGTAGTGAAGTGATGGAATACCTTTCTTACTTTTGTGGAGTTACATCTGATGCTAAGAATTTGACCTCCAACTAAGCAAACATTTTAATGAGCAAAAGTTAGTGTTATTAAAGTTTTTTTATGATAGATCCAAATTGAGGACCTGTGTCCTGTTTTTATAAGATTGCAACCCAGCTATGCTCATTTGTTTATGTTTTGTATATGGCTGCTTTTGTGTTACAGTGGTAGAGTTTAGTAGTTAGGACAGAGACCTGCAAAGCAAAATAATTTACAGTCTGGCCCTTTACAGAAAAGTTTGCTGACTCATGGTCAAAATAAATGAAAATTTTTTGTGTTAGGGTTGTTAAGCTAGGGTTCTTTTTGGTATCATATGCTTATTTTATGTAAATCTCTCAATAAAAAATTATTTTTAAGAGACAGGGTCTCCCTCTGTCGTTCATGCTAGAGTACAGTGGCTCA