Transcript asmbl_106992

Sequence
Transcript Sequence for observation asmbl_106992 of TGE0059530:
GGAAAACTTTTATGTACAGTATTTTTACTTTGGGTATATGTTTATCTTTTAGCAAGTTGAAAGACTTAATTTGCTGCTTGCTCACTATTTTGTAATTATTTGGGAGCAGCAGTAATAAGCCAGCTTTTTGGAATAGGATGTTCCTGATGTGTGGTTATGTAGGAAGAATGATGTTTTAATATACTGCCCAGTAAACTGGTGCAGTTTGGAAAAGGTGTGTTATTGATGTGGATAATATTTAAGGCAATTTTTTTTAAGCATTTTAATACTGCTTTTTGTCTTTACAGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGAGAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTACCTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGACCAGCAGAGTGGTTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTATGTTCTAAAAATAGTTTTTTTTTGTCATTTACAATAGTAGTTTTTATAATCTATATTGTTCATAAAACAATGCTTAATTTAAGAGTTTCACAGCACCCAGAAGTGCTTACCATATTATAACATAGTGACTTTCAAAGATATGTAACACAGGTGCTCTTAAGCTTTTGCCTTTTTGTCCTATTATTAACAAGTCAGTAAAGTTAACAGGTAAAGTACTGCTAATGGGTACAAATTAAGGAATTGCAGCAAAAAAGTATTGCCTACTAACTCTGACATTATACCTTGTTTGTACCCGCCAGCGGGAACTTCATTGCAGGCCCTGTGTCGCGCTGACTTCACGATTCTCACAGGCCCGCTCAATGCGGACAGGGTACGAGATGCTCACGCTCTCGAATGCTGCCGTTTGGTATGGTCTCTTCCAACATCCTGTATCAGCATTATAAAATAAAATGGATACTTCAAGCTTTGCCTTCACTTATTTCTTTGCTTTTTAAAAACTATTTGTAATGTAATTTTAATGCATTTTTTACAGGCCCAGTAATGGTTAAATACGTCAGCTTACTGAATAATTTTAACTATTTATTCTTCTAAGGATACAGCTTGTCTCTGGATTTTCCAGTCTTAATTTTATATTTTATTAATCTATTTTAATGCTTGCTTTTCCCATTTATAGACGTTGTAGCAGTAATTGCAAGAAGTTCTTGAGCTGAATTCCTGTTGTGACAACTTCCTATAATTACAGTAGATAACTTTTTCTTTTAGTCGTATATAACTTTTCTATAACTTGTGATGGACAAGAGATATGCTTATCCAATAAAATAAGCTTAAATATTAGATGCTCTTGGGTCAAAATGTCCTTTTACCAAATTGACCTTTTTATGAGTTCTTTGGGTAAATACTTTAAAGCTTTTTATATTTTAAAGAATACTTGTAAAAGCATATCACATCTTAAACCAGTGGTGCACATGTGGATTTACAGCTCATGGACTCTACTGTTCAGCTTTAATTTATAAAACATATCACACATTTAATGTTATACAGTATTTACATATAGTGGAACATAGGGATAACTCAGTTTTATGTAAATTTTTGTTAAGTGTTGTAGCCTGCCCAGAGTGACTTCTATTTTTTCTTCTTTGTCTCCAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAAATTGTCATGGATTCAAGTTATTAAAAGCATAAGTTTGGAAGACAGGCTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGATTTTTAGAGCTGTGGTGGACTTCATAGATGAATTCAAGTGTTGAGGGAGGATTAAAGAAATATATACCGTGTTTATGTGTGTGTGCTTATTTGTTTGAATGATTTTATTTTCCATTTCTCAAAGGTTTTATTTTTTTGGTTAGGGCCTTAAAATTTCAGGACTGTGATTATTAGTATGTGTGCCTAAGGAACTTTTTGAGTCACTCTTAAGAAAGTGAAACTGAAGAGTCTAAGTGATAACTATAGGATTAAGTCAGAATTGTTTTTCCTGTCATTTGTTGGAAGCTTCTTGAGTTCTGTTATTAGCATTCAGGGAATTGATACCCATCAACTTGAATGGAAAATCGTTTGTAGGTATTACTTAAGTGAATGTTAAGAGTTCCACCCTGAGTGGTAATCTAAGGCTGTGCAGTCAGTTACTTCAGACTGCTCAGAATAGTTCATTAGAAAGGTAACAAATGAGAAATGTATTATTATACAGTTCTATAGTAGTGAAGTGATGGAATACCTTTCTTACTTTTGTGGAGTTACATCTGATGCTAAGAATTTGACCTCCAACTAAGCAAACATTTTAATGAGCAAAAGTTAGTGTTATTAAAGTTTTTTTATGATAGATCCAAATTGAGGACCTGTGTCCTGTTTTTATAAGATTGCAACCCAGCTATGCTCATTTGTTTATGTTTTGTATATGGCTGCTTTTGTGTTACAGTGGTAGAGTTTAGTAGTTAGGACAGAGACCTGCAAAGCAAAATAATTTACAGTCTGGCCCTTTACAGAAAAGTTTGCTGACTCATGGTCAAAATAAATGAAAATTTTTTGTGTTAGGGTTGTTAAGCTAGGGTTCTTTTTGGTATCATATGCTTATTTTATGTAAATCTCTCAATAAAAAATTATTTTTAAGAGACAGGGTCTCCCTCTGTCGTTCATGCTAGAGTACAGTGGCTCA