Transcript asmbl_106990

Sequence
Transcript Sequence for observation asmbl_106990 of TGE0001980:
CGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCGGGAGAGAGCGGGAGTGTGCGCCGCGCGAGAGTGGGAGGCGAAGGGGGCAGGCCAGGGAGAGGCGCAGGAGCCTTTGCAGCCACGCGCGCGCCTTCCCTGTCTTGTGTGCTTCGCGAGGTAGAGCGGGCGCGCGGCAGCGGCGGGGATTACTTTGCTGCTAGTTTCGGTTCGCGGCAGCGGCGGGTGTAGTCTCGGCGGCAGCGGCGGAGACACTAGCACTATGTCGGAGGAGCAGTTCGGCGGGGACGGGGCGGCGGCAGCGGCAACGGCGGCGGTAGGCGGCTCGGCGGGCGAGCAGGAGGGAGCCATGGTGGCGGCGACACAGGGGGCAGCGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGGAACCGCGTCTGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATTGACGCCAGTAAGAACGAGGAGGATGAAGGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGCGACGGCACAGCGGGAAGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGAGAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTACCTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGACCAGCAGAGTGGTTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAA