Transcript asmbl_106989

Sequence
Transcript Sequence for observation asmbl_106989 of TGE0059529:
TGTAGTCTCGGCGGCAGCGGCGGAGACACTAGCACTATGTCGGAGGAGCAGTTCGGCGGGGACGGGGCGGCGGCAGCGGCAACGGCGGCGGTAGGCGGCTCGGCGGGCGAGCAGGAGGGAGCCATGGTGGCGGCGACACAGGGGGCAGCGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGGAACCGCGTCTGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATTGACGCCAGTAAGAACGAGGAGGATGAAGGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGAGAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTACCTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGTGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAACCAGCAGAGTGGTTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAA