Transcript asmbl_106829

Sequence
Transcript Sequence for observation asmbl_106829 of TGE0057544:
CTACTGCGAGGTAAGGATGTTTCTGTGCTCGTGGGGGTACTGGGAATCTGAAACCATCTGCTCTGGGAAAGGCTGCGGCGCGGCTCCCACTCTCGGAACCTTGTCCTGTTTGTCCCCCAGCTCGGCAAGCGCCATATGAGCCTGGCGGCGCCAGATGCGAATCCTGTTGTGGGCTTTTTGGCCTATTCCCGCCCCTCAGTCTTGCCGGGATGGCACCGCCCGCATAGGACTTCCAGGGTTGGGCTGAGTGGGAGTTCGACTGCTGGGCCTCGTAATTCTCGCTTTGGGGCTGCTCCTTCCAGGCTGGGACACACTGGGGCCCGCTGTCGGTCTCCCGTCCTCCGACATCTTGTCTGGAACTTCCGCCTGGCAGTCTCCAGTAGGAGTGGAGCTCTGTGCGGCGTAGTTTGGTGGAAAAACGGGCCTTGCGTCGGCCTCACCCCCAGTGTTTGTGTTTCAGAATGAAGACTATTCTCAGCAATCAGACTGTCGACATTCCAGAAAATGTCGACATTACTCTGAAGGGACGCACAGTTATCGTGAAGGGCCCCAGAGGAACCCTGCGGAGGGACTTCAATCACATCAATGTAGAACTCAGCCTTCTTGGAAAGAAAAAAAAGAGGCTCCGGGTTGACAAATGGTGGGGTAACAGAAAGGAACTGGCTACCGTTCGGACTATTTGTAGTCATGTACAGAACATGATCAAGGGTGTTACACTGGGCTTCCGTTACAAGATGAGGTCTGTGTATGCTCACTTCCCCATCAACGTTGTTATCCAGGAGAATGGGTCTCTTGTTGAAATCCGAAATTTCTTGGGTGAAAAATATATCCGCAGGGTTCGGATGAGACCAGGTGTTGCTTGTTCAGTATCTCAAGCCCAGAAAGATGAATTAATCCTTGAAGGAAATGACATTGAGCTTGTTTCAAATTCAGCGGCTTTGATTCAGCAAGCCACAACAGTTAAAAACAAGGATATCAGGAAATTTTTGGATGGTATCTATGTCTCTGAAAAAGGAACTGTTCAGCAGGCTGATGAATAAGATCTAAGAGTTACCTGGCTACAGAAAGAAGATGCCAGATGACACTTAAGACCTACTTGTGATATTTAAATGATGCAATAAAAGACCTATTGATTTGGAC