Transcript asmbl_10643

Sequence
Transcript Sequence for observation asmbl_10643 of TGE0059527:
CGAGCTGGCCGGCGAGCGGGCGGCTGCGGGCGGCGCGGAGCGGGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGCACAGACCCCCCCACCCCCGCCGGCCGCTGTGGCGGTCGCAGTGACACCAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTGGCGCTGCGATGGTGACTTTGACTGTGAGGACCGAACTGATGAAGCCAACTGCCCCACCAAGCGTCCTGAGGAAGTGTGCGGGCCCACACAGTTCCGATGCGTCTCTACCAACATGTGCATCCCAGCCAGCTTCCACTGTGACGAGGAGAGCGACTGTCCTGACCGGAGCGACGAGTTTGGCTGCATGCCCCCCCAGGTGGTGACACCTCCCCGGGAGTCCATCCAGGCTTCCCGGGGCCAGACAGTGACCTTCACCTGCGTGGCCATTGGCGTCCCCACCCCCATCATCAATTGGAGGCTCAACTGGGGCCACATCCCCTCTCATCCCAGGGTGACAGTGACCAGCGAGGGTGGCCGTGGCACACTGATCATCCGTGATGTGAAGGAGTCAGACCAGGGTGCCTACACCTGTGAGGCCATGAACGCCCGGGGCATGGTGTTTGGCATTCCTGACGGTGTCCTTGAGCTCGTCCCACAACGAGGCCCCTGCCCTGACGGCCACTTCTACCTGGAGCACAGCGCCGCCTGCCTGCCCTGCTTCTGCTTTGGCATCACCAGCGTGTGCCAGAGCACCCGCCGCTTCCGGGACCAGATCAGGCTGCGCTTTGACCAACCCGATGACTTCAAGGGTGTGAATGTGACAATGCCTGCGCAGCCCGGCACGCCACCCCTCTCCTCCACGCAGCTGCAGATCGACCCATCCCTGCACGAGTTCCAGCTAGTCGACCTGTCCCGCCGCTTCCTCGTCCACGACTCCTTCTGGGCTCTGCCTGAACAGTTCCTGGGCAACAAGGTGGACTCCTATGGCGGCTCCCTGCGTTACAACGTGCGCTACGAGTTGGCCCGTGGCATGCTGGAGCCAGTGCAGCGGCCGGACGTGGTCCTCATGGGTGCCGGGTACCGCCTCCTCTCCCGAGGCCACACACCCACCCAACCTGGTGCTCTGAACCAGCGCCAGGTCCAGTTCTCTGAGGAGCACTGGGTCCATGAGTCTGGCCGGCCGGTGCAGCGCGCGGAGCTGCTGCAGGTGCTGCAGAGCCTGGAGGCCGTGCTCATCCAGACCGTGTACAACACCAAGATGGCCAGCGTGGGACTTAGCGACATCGCCATGGATACCACCGTCACCCATGCCACCAGCCATGGCCGTGCCCACAGTGTGGAGGAGTGCAGATGCCCCATTGGCTATTCTGGCTTGTCCTGCGAGAGCTGTGATGCCCACTTCACTCGGGTGCCTGGTGGGCCCTACCTGGGCACCTGCTCTGGTTGCAATTGCAATGGCCATGCCAGCTCCTGTGACCCTGTGTATGGCCACTGCCTGAATTGCCAGCACAACACGGAGGGGCCACAGTGCAACAAGTGCAAGGCTGGCTTCTTTGGGGACGCCATGAAGGCCACGGCCACTTCCTGCCGGCCCTGCCCTTGCCCATACATCGATGCCTCCCGCAGATTCTCAGACACTTGCTTCCTGGACACGGATGGCCAAGCCACATGTGACGCCTGTGCCCCAGGCTACACTGGCCGCCGCTGTGAGAGCTGTGCCCCCGGATACGAGGGCAACCCCATCCAGCCCGGCGGGAAGTGCAGGCCCGTCAACCAGGAGATTGTGCGCTGTGACGAGCGTGGCAGCATGGGGACCTCCGGGGAGGCCTGCCGCTGTAAGAACAATGTGGTGGGGCGCTTGTGCAATGAATGTGCTGACGGCTCTTTCCACCTGAGTACCCGAAACCCCGATGGCTGCCTCAAGTGCTTCTGCATGGGTGTCAGTCGCCACTGCACCAGCTCTTCATGGAGCCGTGCCCAGTTGCATGGGGCCTCTGAGGAGCCTGGTCACTTCAGCCTGACCAACGCCGCAAGCACCCACACCACCAACGAGGGCATCTTCTCCCCCACGCCCGGGGAACTGGGATTCTCCTCCTTCCACAGACTCTTATCTGGACCCTACTTCTGGAGCCTCCCTTCACGCTTCCTGGGGGACAAGGTGACCTCCTATGGAGGAGAGCTGCGCTTCACAGTGACCCAGAGGTCCCAGCCGGGCTCCACACCCCTGCACGGGCAGCCGTTGGTGGTGCTGCAAGGTAACAACATCATCCTAGAGCACCATGTGGCCCAGGAGCCCAGCCCCGGCCAGCCCAGCACCTTCATTGTGCCTTTCCGGGAGCAAGCATGGCAGCGGCCCGATGGGCAGCCAGCCACACGGGAGCACCTGCTGATGGCACTGGCAGGCATCGACACCCTCCTGATCCGAGCATCCTACGCCCAGCAGCCCGCTGAGAGCAGGGTCTCTGGCATCAGCATGGACGTGGCTGTGCCCGAGGAAACCGGCCAGGACCCCGCGCTGGAAGTGGAACAGTGCTCCTGCCCACCCGGGTACCGTGGGCCGTCCTGCCAGGACTGTGACACAGGCTACACACGCACGCCCAGTGGCCTCTACCTGGGTACCTGTGAACGCTGCAGCTGCCATGGCCACTCAGAGGCCTGCGAGCCAGAAACAGGTGCCTGCCAGGGCTGCCAGCATCACACGGAGGGCCCTCGGTGTGAGCAGTGCCAGCCAGGATACTACGGGGACGCCCAGCGGGGGACACCACAGGACTGCCAGCTGTGCCCCTGCTACGGAGACCCTGCTGCCGGCCAGGCTGCCCACACTTGTTTTCTGGACACAGACGGCCACCCCACCTGTGATGCGTGCTCCCCAGGCCACAGTGGGCGTCACTGTGAGAGGTGCGCCCCTGGCTACTATGGCAACCCCAGCCAGGGCCAGCCATGCCAGAGAGACAGCCAGGTGCCAGGGCCCATAGGCTGCAACTGTGACCCCCAAGGCAGCGTCAGCAGCCAGTGTGATGCTGCTGGTCAGTGCCAGTGCAAGGCCCAGGTGGAAGGCCTCACTTGCAGCCACTGCCGGCCCCACCACTTCCACCTGAGTGCCAGCAACCCAGACGGCTGCCTGCCCTGCTTCTGTATGGGCATCACCCAGCAGTGCGCCAGCTCTGCCTACACACGCCACCTGATCTCCACCCACTTTGCCCCTGGGGACTTCCAAGGCTTTGCCCTGGTGAACCCACAGCGAAACAGCCGCCTGACAGGAGAATTCACTGTGGAACCCGTGCCCGAGGGTGCCCAGCTCTCTTTTGGCAACTTTGCCCAACTCGGCCATGAGTCCTTCTACTGGCAGCTGCCGGAGACATACCAGGGAGACAAGGTGGCGGCCTACGGTGGGAAGTTGCGATACACCCTCTCCTACACAGCAGGCCCACAGGGCAGCCCACTCTCTGACCCCGATGTGCAGATCACGGGCAACAACATCATGCTAGTGGCCTCCCAGCCAGCGCTGCAGGGCCCTGAGAGGAGGAGCTACGAGATCATGTTCCGAGAGGAATTCTGGCGCCGGCCCGATGGGCAGCCGGCCACACGCGAGCACCTCCTGATGGCACTGGCCGACCTGGATGAGCTCCTGATCCGGGCCACGTTCTCCTCCGTGCCGCTGGCGGCCAGCATCAGCGCAGTCAGCCTGGAGGTCGCCCAGCCGGGGCCCTCAAACAGACCCCGCGCCCTCGAGGTGGAGGAGTGCCGCTGCCCGCCAGGCTACATCGGTCTGTCCTGCCAGGACTGTGCCCCCGGCTACACGCGCACCGGGAGTGGGCTCTACCTCGGCCACTGCGAGCTATGTGAATGCAATGGCCACTCAGACCTGTGCCACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGCCCGGCACCAGACCCACGGCTCGCTGCTGCGGCTGCACCAGGTGACCCCGGCCGACTCAGGCGAGTATGTGTGCCATGTGGTGGGCACCTCCGGCCCCCTAGAGGCCTCAGTCCTGGTCACCATCGAAGCCTCTGTCATCCCTGGACCCATCCCACCTGTCAGGATCGAGTCTTCATCCTCCACAGTGGCCGAGGGCCAGACCCTGGATCTGAGCTGCGTGGTGGCAGGGCAGGCCCACGCCCAGGTCACATGGTACAAGCGTGGGGGCAGCCT