Transcript asmbl_10642

Sequence
Transcript Sequence for observation asmbl_10642 of TGE0059526:
CGAGCTGGCCGGCGAGCGGGCGGCTGCGGGCGGCGCGGAGCGGGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTGGCGCTGCGATGGTGACTTTGACTGTGAGGACCGAACTGATGAAGCCAACTGCCCCACCAAGCGTCCTGAGGAAGTGTGCGGGCCCACACAGTTCCGATGCGTCTCTACCAACATGTGCATCCCAGCCAGCTTCCACTGTGACGAGGAGAGCGACTGTCCTGACCGGAGCGACGAGTTTGGCTGCATGCCCCCCCAGGTGGTGACACCTCCCCGGGAGTCCATCCAGGCTTCCCGGGGCCAGACAGTGACCTTCACCTGCGTGGCCATTGGCGTCCCCACCCCCATCATCAATTGGAGGCTCAACTGGGGCCACATCCCCTCTCATCCCAGGGTGACAGTGACCAGCGAGGGTGGCCGTGGCACACTGATCATCCGTGATGTGAAGGAGTCAGACCAGGGTGCCTACACCTGTGAGGCCATGAACGCCCGGGGCATGGTGTTTGGCATTCCTGACGGTGTCCTTGAGCTCGTCCCACAACGAGGCCCCTGCCCTGACGGCCACTTCTACCTGGAGCACAGCGCCGCCTGCCTGCCCTGCTTCTGCTTTGGCATCACCAGCGTGTGCCAGAGCACCCGCCGCTTCCGGGACCAGATCAGGCTGCGCTTTGACCAACCCGATGACTTCAAGGGTGTGAATGTGACAATGCCTGCGCAGCCCGGCACGCCACCCCTCTCCTCCACGCAGCTGCAGATCGACCCATCCCTGCACGAGTTCCAGCTAGTCGACCTGTCCCGCCGCTTCCTCGTCCACGACTCCTTCTGGGCTCTGCCTGAACAGTTCCTGGGCAACAAGGTGGACTCCTATGGCGGCTCCCTGCGTTACAACGTGCGCTACGAGTTGGCCCGTGGCATGCTGGAGCCAGTGCAGCGGCCGGACGTGGTCCTCATGGGTGCCGGGTACCGCCTCCTCTCCCGAGGCCACACACCCACCCAACCTGGTGCTCTGAACCAGCGCCAGGTCCAGTTCTCTGAGGAGCACTGGGTCCATGAGTCTGGCCGGCCGGTGCAGCGCGCGGAGCTGCTGCAGGTGCTGCAGAGCCTGGAGGCCGTGCTCATCCAGACCGTGTACAACACCAAGATGGCCAGCGTGGGACTTAGCGACATCGCCATGGATACCACCGTCACCCATGCCACCAGCCATGGCCGTGCCCACAGTGTGGAGGAGTGCAGATGCCCCATTGGCTATTCTGGCTTGTCCTGCGAGAGCTGTGATGCCCACTTCACTCGGGTGCCTGGTGGGCCCTACCTGGGCACCTGCTCTGGTTGCAATTGCAATGGCCATGCCAGCTCCTGTGACCCTGTGTATGGCCACTGCCTGAATTGCCAGCACAACACGGAGGGGCCACAGTGCAACAAGTGCAAGGCTGGCTTCTTTGGGGACGCCATGAAGGCCACGGCCACTTCCTGCCGGCCCTGCCCTTGCCCATACATCGATGCCTCCCGCAGATTCTCAGACACTTGCTTCCTGGACACGGATGGCCAAGCCACATGTGACGCCTGTGCCCCAGGCTACACTGGCCGCCGCTGTGAGAGCTGTGCCCCCGGATACGAGGGCAACCCCATCCAGCCCGGCGGGAAGTGCAGGCCCGTCAACCAGGAGATTGTGCGCTGTGACGAGCGTGGCAGCATGGGGACCTCCGGGGAGGCCTGCCGCTGTAAGAACAATGTGGTGGGGCGCTTGTGCAATGAATGTGCTGACGGCTCTTTCCACCTGAGTACCCGAAACCCCGATGGCTGCCTCAAGTGCTTCTGCATGGGTGTCAGTCGCCACTGCACCAGCTCTTCATGGAGCCGTGCCCAGTTGCATGGGGCCTCTGAGGAGCCTGGTCACTTCAGCCTGACCAACGCCGCAAGCACCCACACCACCAACGAGGGCATCTTCTCCCCCACGCCCGGGGAACTGGGATTCTCCTCCTTCCACAGACTCTTATCTGGACCCTACTTCTGGAGCCTCCCTTCACGCTTCCTGGGGGACAAGGTGACCTCCTATGGAGGAGAGCTGCGCTTCACAGTGACCCAGAGGTCCCAGCCGGGCTCCACACCCCTGCACGGGCAGCCGTTGGTGGTGCTGCAAGGTAACAACATCATCCTAGAGCACCATGTGGCCCAGGAGCCCAGCCCCGGCCAGCCCAGCACCTTCATTGTGCCTTTCCGGGAGCAAGCATGGCAGCGGCCCGATGGGCAGCCAGCCACACGGGAGCACCTGCTGATGGCACTGGCAGGCATCGACACCCTCCTGATCCGAGCATCCTACGCCCAGCAGCCCGCTGAGAGCAGGGTCTCTGGCATCAGCATGGACGTGGCTGTGCCCGAGGAAACCGGCCAGGACCCCGCGCTGGAAGTGGAACAGTGCTCCTGCCCACCCGGGTACCGTGGGCCGTCCTGCCAGGACTGTGACACAGGCTACACACGCACGCCCAGTGGCCTCTACCTGGGTACCTGTGAACGCTGCAGCTGCCATGGCCACTCAGAGGCCTGCGAGCCAGAAACAGGTGCCTGCCAGGGCTGCCAGCATCACACGGAGGGCCCTCGGTGTGAGCAGTGCCAGCCAGGATACTACGGGGACGCCCAGCGGGGGACACCACAGGACTGCCAGCTGTGCCCCTGCTACGGAGACCCTGCTGCCGGCCAGGCTGCCCACACTTGTTTTCTGGACACAGACGGCCACCCCACCTGTGATGCGTGCTCCCCAGGCCACAGTGGGCGTCACTGTGAGAGGTGCGCCCCTGGCTACTATGGCAACCCCAGCCAGGGCCAGCCATGCCAGAGAGACAGCCAGGTGCCAGGGCCCATAGGCTGCAACTGTGACCCCCAAGGCAGCGTCAGCAGCCAGTGTGATGCTGCTGGTCAGTGCCAGTGCAAGGCCCAGGTGGAAGGCCTCACTTGCAGCCACTGCCGGCCCCACCACTTCCACCTGAGTGCCAGCAACCCAGACGGCTGCCTGCCCTGCTTCTGTATGGGCATCACCCAGCAGTGCGCCAGCTCTGCCTACACACGCCACCTGATCTCCACCCACTTTGCCCCTGGGGACTTCCAAGGCTTTGCCCTGGTGAACCCACAGCGAAACAGCCGCCTGACAGGAGAATTCACTGTGGAACCCGTGCCCGAGGGTGCCCAGCTCTCTTTTGGCAACTTTGCCCAACTCGGCCATGAGTCCTTCTACTGGCAGCTGCCGGAGACATACCAGGGAGACAAGGTGGCGGCCTACGGTGGGAAGTTGCGATACACCCTCTCCTACACAGCAGGCCCACAGGGCAGCCCACTCTCTGACCCCGATGTGCAGATCACGGGCAACAACATCATGCTAGTGGCCTCCCAGCCAGCGCTGCAGGGCCCTGAGAGGAGGAGCTACGAGATCATGTTCCGAGAGGAATTCTGGCGCCGGCCCGATGGGCAGCCGGCCACACGCGAGCACCTCCTGATGGCACTGGCCGACCTGGATGAGCTCCTGATCCGGGCCACGTTCTCCTCCGTGCCGCTGGCGGCCAGCATCAGCGCAGTCAGCCTGGAGGTCGCCCAGCCGGGGCCCTCAAACAGACCCCGCGCCCTCGAGGTGGAGGAGTGCCGCTGCCCGCCAGGCTACATCGGTCTGTCCTGCCAGGACTGTGCCCCCGGCTACACGCGCACCGGGAGTGGGCTCTACCTCGGCCACTGCGAGCTATGTGAATGCAATGGCCACTCAGACCTGTGCCACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGCCCGGCACCAGACCCACGGCTCGCTGCTGCGGCTGCACCAGGTGACCCCGGCCGACTCAGGCGAGTATGTGTGCCATGTGGTGGGCACCTCCGGCCCCCTAGAGGCCTCAGTCCTGGTCACCATCGAAGCCTCTGTCATCCCTGGACCCATCCCACCTGTCAGGATCGAGTCTTCATCCTCCACAGTGGCCGAGGGCCAGACCCTGGATCTGAGCTGCGTGGTGGCAGGGCAGGCCCACGCCCAGGTCACATGGTACAAGCGTGGGGGCAGCCT