Transcript asmbl_10623

Sequence
Transcript Sequence for observation asmbl_10623 of TGE0059524:
GTCTTCTGAGGAAACCAAAAAGGATGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATTCCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCTTCCCCACGTCCCAAGATGGATGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGAGTGGTGCATCAGTGGTTGCTATTCGAAAATACATCATCCATAAGTATCCTTCTCTGGAGCTGGAGAGAAGGGGTTATCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGAGTCATCAAACAGGTTAAAGGAAAAGGTGCTTCTGGAAGTTTTGTTGTGGTTCAGAAATCAAGAAAAACACCTCAGAAATCCAGAAACAGAAAGAATAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAGGATGTCCTCCCACTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATATGTGTCTCAGTATTATCCTAAGCTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAACGCTCTGCAGAGAGCAGTAGAGAGGGGCCAGTTAGAACAGATAACTGGCAAAGGTGCTTCGGGGACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCTACCACTGCTCTGAAGAAGTATGTCCTAGAGAATCACCCAGGAACCAATTCTAACTATCAAATGCATTTGCTGAAAAAAACCCTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGGAAAGGGTTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTATCCCAGCCCAGGAGTTCTGTTTCCGAAGAAAGAGCCAGATGATTCTAGAGATGAGGATGAAGATGAAGATGAGTCATCAGAAGAAGACTCTGAGGATGAAGAGCCGCCACCTAAGAGAAGGTTGCAGAAGAAAACCCCAGCCAAGTCCCCAGGGAAGGCCGCATCTGTGAAGCAGAGAGGGTCCAAACCTGCACCTAAAGTCTCAGCTGCCCAGCGGGGGAAAGCTAGGCCCTTGCCTAAGAAAGCACCTCCTAAGGCCAAAACGCCTGCCAAGAAGACCAGACCCTCATCCACAGTCATCAAGAAACCTAGTGGTGGCTCCTCAAAGAAGCCTGCAACCAGTGCAAGAAAGGAAGTAAAATTGCCGGGCAAGGGCAAATCCACCATGAAGAAGTCTTTCAGAGTGAAAAAGTAAATTTTATAGGAAAAAAGGGTATCATGATGAAATTCAAAATCTTATTTTCTAAGGTCAGTGTGCATTTGTTTAGTTTTGATGCTTTTCAAATTACATTATTTTCCTCCCCTATGAACATTGTGGGGAGGGACTCTAAATAAACCAGTTTAGGCATTTGCTAGCTTTAGGTGCTTTTATTGGTGCCTGCCCTTTTCCTTGTTCATTTTAATTTCTGCAATAATCCTGGACTTTCCTAAACTATGTAATGTATACTTGTCCTTTTTCTCTGCCTCCCCCAACCCCCTGTTGTTTTTATGGTCAGCTTTGCCTTTTTTTTTTCTTCCAATTTTATCTAAACAGTTGCAGAGATTTTTATATTTGTAGAAAGCATCAAGAACGGTATGCCAGTCAGGTCCTGGAAGTAAAATGGAGGCACAATATAGCACTGACTGAGTTGTAAAGCCTCCTGCCTGGAGACTTCAGTTATAGCTGTAATAATTAATCTTATTTATAAAAGCCACTCCACTAACCTTTTCTCTCCAACTGTAAACACAGAGACAGCTTTGGGAATAAGCCAAAAACAGGGTGATCTCATTAGATTTTGAAGATATATGACTCCTTTGGGCTACATTTCATATTGATCAATTTCTAGGTATTTTTCACTGGCCCAAAGTATTGCATTCCCTTAACAGCAAGCACAAGTTCTCTATATCACTTGTTTTTTGTTGTTGTTGTTGTTGT