Transcript asmbl_10622

Sequence
Transcript Sequence for observation asmbl_10622 of TGE0059523:
GGCATGAGCCACTGCACCCAGCCTATCGTCTGTTGTTAAATGTTCTAATGCACCTATTAGGTGCACAGAGTACTGTTATATACTCAGAATAAAATTTACATAATGCTTTAAATCTCACAAAATTGTTTTGATAAACATACTCTTATAATTCTTGCAACACCTTGGGAAATAGTTGGTTCTATATTACTGTTTTATAGCTGAGGAGAAAGACTCACATCATTTACTAAGATCATATAGCTAGCTAGTAAATGTTTGAGTGAAAATACAAACAAAGGTTTTCTGACTTTAAGAGCTTGAGTTTTTTCCACTATACCATATTGCATCTGTTGTAATTGTTAACTAATGTGCATTTTAAAATTCTCATTTGTCTTATGTACTGAGCCCTTATACCAGTGCTAATTTATGTGACTCCTTTCTCCTGCAGCTAAGAGAAAAATACCTTTTTAATTCATTTATAGTACCCAGTTTTTAAAGAAGATTTATTTTGTAAAATTTTGCTTATGGTACATGTCATCTTAGCCTGTAAATAAATTAAAGCATTAATTTTTATCCCTCCCTGGTCTTTTCCTCCTTCTGACTTTATACGTCTTTCTAGAGAGCTTATCTTCTATAATAACAATTCTTTGTTTTAAAGTGAGAAAGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAAACAATTCCTTCCTGGGCTACCCTTTCTGCCAGCCAGCTAGCCAGGGCCCAGAAACAAACACCGATGGCTTCTTCCCCACGTCCCAAGATGGATGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGAGTGGTGCATCAGTGGTTGCTATTCGAAAATACATCATCCATAAGTATCCTTCTCTGGAGCTGGAGAGAAGGGGTTATCTCCTTAAACAAGCACTGAAAAGAGAATTAAATAGAGGAGTCATCAAACAGGTTAAAGGAAAAGGTGCTTCTGGAAGTTTTGTTGTGGTTCAGAAATCAAGAAAAACACCTCAGAAATCCAGAAACAGAAAGAATAGGAGCTCTGCAGTGGATCCAGAACCACAAGTAAAATTGGAGGATGTCCTCCCACTGGCCTTTACTCGCCTTTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATATGTGTCTCAGTATTATCCTAAGCTTAGAGTGGACATCAGGCCTCAGCTGTTGAAGAACGCTCTGCAGAGAGCAGTAGAGAGGGGCCAGTTAGAACAGATAACTGGCAAAGGTGCTTCGGGGACATTCCAGCTGAAGAAATCAGGGGAGAAACCCCTGCTTGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAATGAGCCGAAGACCTGCTCTACCACTGCTCTGAAGAAGTATGTCCTAGAGAATCACCCAGGAACCAATTCTAACTATCAAATGCATTTGCTGAAAAAAACCCTGCAGAAATGCGAAAAGAATGGGTGGATGGAACAGATCTCTGGGAAAGGGTTCAGTGGCACCTTCCAGCTCTGTTTTCCCTATTATCCCAGCCCAGGAGTTCTGTTTCCGAAGAAAGAGCCAGATGATTCTAGAGATGAGGATGAAGATGAAGATGAGTCATCAGAAGAAGACTCTGAGGATGAAGAGCCGCCACCTAAGAGAAGGTTGCAGAAGAAAACCCCAGCCAAGTCCCCAGGGAAGGCCGCATCTGTGAAGCAGAGAGGGTCCAAACCTGCACCTAAAGTCTCAGCTGCCCAGCGGGGGAAAGCTAGGCCCTTGCCTAAGAAAGCACCTCCTAAGGCCAAAACGCCTGCCAAGAAGACCAGACCCTCATCCACAGTCATCAAGAAACCTAGTGGTGGCTCCTCAAAGAAGCCTGCAACCAGTGCAAGAAAGGAAGTAAAATTGCCGGGCAAGGGCAAATCCACCATGAAGAAGTCTTTCAGAGTGAAAAAGTAAATTTTATAGGAAAAAAGGGTATCATGATGAAATTCAAAATCTTATTTTCTAAGGTCAGTGTGCATTTGTTTAGTTTTGATGCTTTTCAAATTACATTATTTTCCTCCCCTATGAACATTGTGGGGAGGGACTCTAAATAAACCAGTTTAGGCATTTGCTAGCTTTAGGTGCTTTTATTGGTGCCTGCCCTTTTCCTTGTTCATTTTAATTTCTGCAATAATCCTGGACTTTCCTAAACTATGTAATGTATACTTGTCCTTTTTCTCTGCCTCCCCCAACCCCCTGTTGTTTTTATGGTCAGCTTTGCCTTTTTTTTTTCTTCCAATTTTATCTAAACAGTTGCAGAGATTTTTATATTTGTAGAAAGCATCAAGAACGGTATGCCAGTCAGGTCCTGGAAGTAAAATGGAGGCACAATATAGCACTGACTGAGTTGTAAAGCCTCCTGCCTGGAGACTTCAGTTATAGCTGTAATAATTAATCTTATTTATAAAAGCCACTCCACTAACCTTTTCTCTCCAACTGTAAACACAGAGACAGCTTTGGGAATAAGCCAAAAACAGGGTGATCTCATTAGATTTTGAAGATATATGACTCCTTTGGGCTACATTTCATATTGATCAATTTCTAGGTATTTTTCACTGGCCCAAAGTATTGCATTCCCTTAACAGCAAGCACAAGTTCTCTATATCACTTGTTTTTTGTTGTTGTTGTTGTTGT