Transcript asmbl_60978

Sequence
Transcript Sequence for observation asmbl_60978 of TGE0056581:
TTCGCTAACGCGCGAGGAGTAGGCTGCATAGACCCGGCGCAGGAGGTGTTCATTTTCGGATCCAGCCCTGTAGTCACTTTAGCTAAACCCGGTTCCAAAGGGGTGGGAGTCGTCGGAGAGGAATGGCCTCTGTATCTCCGGAGACGGAAACACCAGGACGAAGAGGCCCTAAGAACAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACCAGATCGGCACCAAGTTTTGGGAAGTGATCAGCGATGAGCACGGCATCGACCCGGCCGGAGGCTACGTGGGAGACTCGGCGCTGCAGCTGGAGAGAATCAACGTCTACTACAATGAGTCATCGTCTCAGAAATATGTGCCCAGGGCCGCCCTGGTGGACTTAGAGCCAGGCACCATGGACAGCGTGCGGTCTGGGCCTTTTGGGCAGCTTTTCCGGCCTGACAACTTCATCTTTGGCCAGACGGGTGCAGGGAACAACTGGGCGAAAGGGCACTACACGGAGGGCGCGGAGCTGGTGGACGCAGTGCTGGACGTGGTGCGGAAGGAGTGCGAGCACTGCGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTGGGCGGCGGCACGGGCTCAGGCATGGGCACGCTGCTCATCAGCAAGATCCGTGAGGAGTTCCCGGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTGGTGGAGCCCTACAATGCCACACTGTCGGTGCACCAGCTGGTGGAGAATACAGACGAGACCTACTGCATCGACAACGAGGCGCTCTATGACATCTGCTTCCGCACTCTGAAGCTGACAACGCCCACCTACGGGGACCTCAACCACCTGGTGTCCGCCACCATGAGTGGGGTCACCACCTCGCTGCGCTTCCCGGGCCAGCTCAATGCTGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCGCGCCTGCACTTCTTCATGCCTGGCTTCGCGCCGCTCACCAGCCGCGGCAGCCAGCAGTACCGGGCCCTGACCGTGCCCGAGCTCACCCAGCAGATGTTCGACGCCAGGAACATGATGGCCGCCTGCGATCCGCGCCATGGCCGCTACCTGACCGTGGCCACCGTGTTCCGCGGGCCCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGTAAGAACAGCAGCTACTTCGTGGAGTGGATTCCCAACAACGTGAAGGTGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGGCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCTCAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTTCACGGGTGAGGGCATGGATGAAATGGAGTTCACCGAGGCGGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGATGCCACCGCCAATGACGGGGAGGAAGCTTTTGAGGATGAGGAAGAGGAGATCGATGGATAGTCGGAATAGAGCCGCCCCAACTCAGATCCTACAACACGCAAGTTCCTTCTTGAACCCTGGTGCCTCCTACCCTATGGCCCTGAATGGTGCACTGGTTTAATTGTGTTGGTGTCGGCCCCTCACAAATGCAGCCAAGTCATGTAATTAGTCATCTGGAACAAAGACTAAAAACAGCAGAGAATTGCGGGTTCTACCCAGTCAGAAGATCACACCATGGAGACTTTCTACTAGAGGACTTGAAAGAGAACTGAGGGGCCACAAAATAAACTTCACCTTCCATTAAGTGTTCAAGCATGTCTGCAAATTAGGAGGGAGTTAGAAACAGTCTTTTTCATCCTTTGTGATGAAGCCTGAAATTGTGCCGTGTTGCCTTATATGAATATGCAGTATGGGACTTTGAAATAATGATTCATAATAAAATACTAAACGTGTGTCTTCATCTCTCTAGCCATGTGCATAAATGACGTAAGTTACTTTGTATGGTTACAATGGCTACTTGGGTCACTGGTCTCTCCCTGGGGTGAACTCCTCCCCACTTCAGTTCACGAAAACAACAGAGGAAAGGGCTCTTCTTTAAATGGAGGCTTTAAGGGG