Transcript asmbl_58598

Sequence
Transcript Sequence for observation asmbl_58598 of TGE0057047:
CCGCTGCCAGCTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCGCGTTTCTCTGCCGGTGAGCGCCCCGCCCCGGGGCCTGAGCTGGACGTCGCAGGCCTGCGCCCCCCGACCCCGGCTGGCCCCGCTTCCAGCTGCCGAGGCCTCGTCGCGCCTTCCCCGGGAACAAAAGGCGGGGTCGCAATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGTTTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACACCAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAGCACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACT