Transcript asmbl_25981

Sequence
Transcript Sequence for observation asmbl_25981 of TGE0000927:
CCGGCTCGTGATTGGCCAGCACGCCGTGGTTTAAAGCGGTCGGCGCGGGAACCAGGGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGCTGCATTAACCTGCCCACTGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATTCTCGGGCCGATGTTCTCAGGAAAAAGCACAGAGTTGATGAGACGCGTCCGTCGCTTCCAGATTGCTCAGTACAAGTGCCTGGTGATCAAGTATGCCAAAGACACTCGCTACAGCAGCAGCTTCTGCACACATGACCGGAACACCATGGAGGCACTGCCCGCCTGCCTGCTCCGAGACGTGGCCCAGGAGGCCCTGGGCGTGGCTGTCATAGGCATCGACGAGGGGCAGTTTTTCCCTGACATCGTGGAGTTCTGCGAGGCCATGGCCAACGCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTGGGGCCATCCTGAACCTGGTGCCGCTGGCCGAGAGCGTGGTGAAGCTGACGGCGGTGTGCATGGAGTGCTTCCGGGAAGCCGCCTATACCAAGAGGCTCGGCACAGAGAAGGAGGTCGAGGTGATTGGGGGAGCAGACAAGTACCACTCCGTGTGTCGGCTCTGCTACTTCAAGAAGGCCTCAGGCCAGCCTGCCGGGCCGGACAACAAAGAGAACTGCCCAGTGCCAGGAAAGCCAGGGGAAGCCGTGGCTGCCAGGAAGCTCTTTGCCCCACAGCAGATTCTGCAATGCAGCCCTGCCAACTGAGGGACCTGCGAGGGCCGCCCGCTCCCTTCCTGCCACTGCCGCCTACTGGACGCTGCCCTGCATGCTGCCCAGCCACTCCAGGAGGAAGTCGGGAGGCGTGGAGGGTGACCACACCTTGGCCTTCTGGGAACTCTCCTTTGTGTGGCTGCCCCACCTGCCGCATGCTCCCTCCTCTCCTACCCACTGGTCTGCTTAAAGCTTCCCTCTCAGCTGCTGGGACGATCGCCCAGGCTGGAGCTGGCCCCGCTTGGTGGCCTGGGATCTGGCACACTCCCTCTCCTTGGGGTGAGGGACAGAGCCCCACGCTGTTGACATCAGCCTGCTTCTTCCCCTCTGCGGCTTTCACTGCTGAGTTTCTGTTCTCCCTGGGAAGCCTGTGCCAGCACCTTTGAGCCTTGGCCCACACTGAGGCTTAGGCCTCTCTGCCTGGGATGGGCTCCCACCCTCCCCTGAGGATGGCCTGGATTCACGCCCTCTTGTTTCCTTTTGGGCTCAAAGCCCTTCCTACCTCTGGTGATGGTTTCCACAGGAACAACAGCATCTTTCACCAAGATGGGTGGCACCAACCTTGCTGGGACTTGGATCCCAGGGGCTTATCTCTTCAAGTGTGGAGAGGGCAGGGTCCACGCCTCTGCTGTAGCTTATGAAATTAACTAATTGAAAATTCACTGGTTGGTGGACGCACATTTCTCTTTCACCTGGGTTTCCCTGGGTCTCATGGACAGCTCCAACTTGATTTGGG