Transcript asmbl_95981

Sequence
Transcript Sequence for observation asmbl_95981 of TGE0059510:
ATTCCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCGTGAGTGTCTGTGATGTGGGTTGATGGGGCAGAGGTGGGGACCCAGCC