Transcript asmbl_77286

Sequence
Transcript Sequence for observation asmbl_77286 of TGE0056843:
CAGGGCCGTTCTTGAGGGCTGCCCTCCGGCCGCCTGACTGGAAAACCAGGCACTCCACCCCCTCCTCTCCGGGCCCCCGTCCTCCCCCGGAGAATACGACCTTTCGGCCATGTTAGCCAGGAGCGAGGGGCAGGGCTAAGGGGCCGGCGGCCACTCGGCATCTGGGTTTTAGTCAGGCAGTGCTCCAGGCGCCTGGCTGCCAGGCTACGGGAGAAAAGTCCTCCGCTCGGCCGCACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCTGCCTTCAGGATCCTCCGCTCCCGAGGTTATATATGCCGCAATTTTACAGGGTCTTCTGCTTTGCTGACCAGAACCCATATTAACTATGGAGTCAAAGGGGATGTGGCAGTTGTTCGAATTAACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAGTTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGCCAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGGAGGAGGACTTGAGGTTGCCATTTCATGCCAATACAGAATAGCAACAAAAGACAGAAAAACAGTATTAGGTACCCCTGAAGTTTTGCTGGGGGCCTTACCAGGAGCAGGAGGCACACAAAGGCTGCCCAAAATGGTGGGTGTGCCTGCTGCTTTGGACATGATGCTGACTGGTAGAAGCATTCGTGCAGACAGGGCAAAGAAAATGGGACTGGTTGACCAACTGGTGGAACCCCTGGGACCAGGACTAAAACCTCCAGAGGAACGGACAATAGAATACCTAGAAGAAGTTGCAATTACTTTTGCCAAAGGACTAGCTGATAAGAAGATCTCTCCAAAGAGAGACAAGGGATTGGTGGAAAAATTGACAGCGTATGCCATGACTATTCCATTTGTCAGGCAACAGGTTTACAAAAAAGTGGAAGAAAAAGTGCGAAAGCAGACTAAAGGCCTTTATCCTGCACCTCTGAAAATAATTGATGTGGTAAAGACTGGAATTGAGCAAGGGAGTGATGCCGGTTATCTCTGTGAATCTCAGAAATTTGGAGAGCTTGTAATGACCAAAGAATCAAAGGCCTTGATGGGACTCTACCATGGTCAGGTCCTGTGCAAGAAGAATAAATTTGGAGCTCCACAGAAGGATGTTAAGCATCTGGCTATTCTTGGTGCAGGGCTGATGGGAGCAGGCATCGCCCAAGTCTCCGTGGATAAGGGGCTAAAGACTATACTTAAAGATGCCACCCTCACTGCGCTAGACCGAGGACAGCAACAAGTGTTCAAAGGATTGAATGACAAAGTGAAGAAGAAAGCTCTAACATCATTTGAAAGGGATTCCATCTTCAGCAACTTGACTGGGCAGCTTGATTACCAAGGTTTTGAAAAGGCCGACATGGTGATTGAAGCTGTGTTTGAGGACCTTAGTCTTAAGCACAGAGTGCTAAAGGAAGTAGAAGCGGTGATTCCAGATCACTGTATCTTTGCCAGTAACACATCTGCTCTCCCAATCAGTGAAATCGCTGCTGTCAGCAAAAGACCTGAGAAGGTGATTGGCATGCACTACTTCTCTCCCGTGGACAAGATGCAGCTGCTGGAGATTATCACGACCGAGAAAACTTCCAAAGACACCAGTGCTTCAGCTGTAGCAGTTGGTCTCAAGCAGGGGAAGGTCATCATTGTGGTTAAGGATGGACCTGGCTTCTATACTACCAGGTGTCTTGCGCCCATGATGTCTGAAGTCATCCGAATCCTCCAGGAAGGAGTTGACCCGAAGAAGCTGGATTCCCTGACCACAAGCTTTGGCTTTCCTGTGGGTGCCGCCACACTGGTGGATGAAGTTGGTGTGGATGTAGCGAAACATGTGGCGGAAGATCTGGGCAAAGTCTTTGGGGAGCGGTTTGGAGGTGGAAACCCAGAACTGCTGACACAGATGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTGGGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGGATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACATCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGATCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTGGCTTCCCGCCTTGTCTGGGAGGGCCTTTCCGCTTTGTGGATCTGTATGGCGCCCAGAAGATAGTGGACCGGCTCAAGAAATATGAAGCTGCCTATGGAAAACAGTTCACCCCATGCCAGCTGCTAGCTGACCATGCTAACAGCCCTAACAAGAAGTTCTACCAGTGAGCAGGCCTCATGCCTCGCTCAGTCAGTGCACTAACCCCAGCTGCCGGCAGTGCTGGTTCTCCAACAGAGTGGTGTCTAGATTTATCAGAGTAACGAGAAGACAAACTCCGGCACTGGGTTTGCTCCCTGATTAAAGTGCCTTCAGCCAAGACCATCTCTCCCTCCTGGTGAAGTGTGACTTCGAATTAGTTTGCACTTCCTGTTGGAAGGTAGAGCCCACTGCTCATTGTATAAGCCCCGAGGCCTAGAGTGGCAGCCAAGAGCCATCTGAAGCCACCTCTCTGCCTGTTCCTCCCAAGAGGCCAGGGTGGCCAGGGGTGGTGAGGGCAGTTCTGCACCCAGCCAAACACATAACAATAAAAACCAAACTCTGTGTCAGCATCTTTGCCCTTCTGGTTTAAACGCCTCCTTCAAAAAGCAATCTGGAAGAAAGCCCTGTGCTTTGGGGGAGTAAGAATGTGTGTGCAGAATTCTAGGCAGCACCTTAGGGAGGGACTGGGATGAGAGAAAGTGGGACCTGGTGGGCTCAACCACACACACCTGTCTGTGCAGATGCTTTGCCCAGGCTTCTCACCACGGTGTACCGGGATATTAAACCTCTTTCCCCA