Transcript asmbl_69172

Sequence
Transcript Sequence for observation asmbl_69172 of TGE0001130:
AGGCACCCCGGGAGGCTATAAGGCCCTCTCCTCCACCCTGCCAGGCTCACTCTGCCCCACAGCCACAGCCCCTGACTGCCGCAGCCCCCACAGAGCCCGCCGCGCACCCCACGTCCCCCACGCCAGCGCCCAGCCATGGAGGCCATCAAGAAGAAAATGCAGATGCTGAAGTTGGACAAGGAGAATGCCATCGACCGCGCGGAGCAGGCGGAGGCGGATAAGAAAGCCGCTGAGGACAAGTGCAAGCAGGTGGAGGAGGAGCTGACGCACCTCCAGAAGAAACTAAAAGGGACAGAGGACGAGCTGGATAAATATTCCGAGGACCTGAAGGACGCGCAGGAGAAGCTGGAGCTCACGGAGAAGAAGGCCTCCGACGCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGACAGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCAGATGAGAGTGAGAGAGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGAGATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAGGTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAGGTGTCTGAACTAAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGAGGCTGCATCTGAAAAGTATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGAGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACACTAAACGAACTTAACTGTATATAAGCAAAACAGAAGAGTCTTGTTCCAACAGAAACTCTGGAGCTCCGTGGGTCTTTCTCTTCTCTTGTAAGAAGTTCCTTTTGTTATTGCCATCTTCGCTTTGCTGGAAATGTCAAGCAAATTATGAATACATGACCAAATATTTTGTATCGGAGAAGCTTTGAGCACCAGTTAAATCTCATTCCTTCCCTTTTTTTTTCAAATGGCACCAGCTTTTTCAGCTCTCTTATTTTTTCCTTAAGTAGCATTTATTCCTAAGGTAGGCAGGGTATTTCCTAGTAAGCATACTTTCTTAAGACGGAGGCCATTTGGTTCCTGGGAGAATAGGCAGCCCCACACTTTGAAGAATACAGACCCCAGTATCTAGTCGTGGATATAATTAAAACGCTGAAGACCATAACCTTTTGGGTCAACTGTTGGTCAAACTATAGGAGAGACCAGGGACCATCACATGGGTAGGGATTTTCCATCCAGAGCCAATAAAAGGACTGGTGGGGGCCGGGGGTGGCTATTGTGGGAAGTCATAACCCACAGATAGATCAACCTAAGAATCCTGGCCCTTCTCCACTCTCCACCATGCAGGACAAACATCTTCTCAAGCAGTCAACGTAGAATGCTTGGGAAATAGTCATAATTACCCACATATAGTAATTAATAGATGGTAATTAATTGATCCTTGATGTGATGTTCTTTTGCATATTTCCTTCATTCTAAAGTTGTTCCCTGGCCGGGAGCGTTGGCTTTCGCCTGTAATCCCAACACTTTGGGAGGC