Transcript asmbl_26647

Sequence
Transcript Sequence for observation asmbl_26647 of TGE0004512:
AGAGAGCGCAGCGCGGCGGCAGCAGGAGCCGAGTAGCGTGCAGAGCCGGTCATGGGCAAGTCAGCTTCCAAGCAGTTTAACAGTGAGGTCCTGAAGGCCCACAACGAGTACCGGCAGCAGCATGGCGTTCCTCCACTGAAGCTCTGCAAGAAGCTCAACCAGGAGGCCCAGCAGTATTCGGAGGCCCTGGCCAGCACGAGGATCCTCAAGCACAGCCCAGAGTCCAGTCGTGGCCAGTGCGGAGAGAACCTAGCTTGGGCATCCTACGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTACAACTTCCAGCAGCCTGGCTTCAACTCTGGGACTGGACACTTCACGGCCATGGTGTGGAAGAACACAAAGAAGATGGGAGTGGGGAAGGCATCTGCAAGTGATGGGTCCTCCTTTGTGGTGGCCAGATACTTCCCAGCAGGGAATGTTGTTAACCAGGGCTTCTTTGAAGAAAATGTGCTGCCTCCAAAGAAATAACTTGTCAAACATAATGGGAAGGTGGCAGACTTAAGAACGTGGTATGAAGTACCTAGAAGAACATTAGCTGTGTGTTTGTCCTTGTGGGTGTACATGCTTGTGTGTGATGCATGTGTGCATCTCTTGCACACATACTCGGATATACAGTTCTGTATGAACTCATTCTTGTCAAAAGAATGAGCATATGAAGGCTTTACTCTGATAGTTACCTAGACCACAATTATTTGGACTTTGGGGGCAAAATCAATTTTTAAACTTTTTTTTTCATTTTTTTAAGCAAACTACTTTTGTACGTTTCTTACTTTTAATATCCATCCCTGGACTTTTTATATTCCTCATGTTTGTGATACTGAGAACTGAAGTTCATTTTTTGTGATCTTCATACATTGTAATCTACTTGTGGTAGATATTTAAAAATATTAAACCTTCATTTAAATGTGACATAAAATGCAGCTTTAAACACATAAATATAAAGCAGCTTCCATGAGAAAACTGGTGTAGGCAGGAGTTCCATCTCACAGAATTACTGAGATTTCTCAGTTGTAAGACATGATGTCATCTGCATGCCTCCTGGAATTCTCTAATGGGATTGCCAAAGAACAAATGGAGAAGAAAACTTTACTTCTTTGCATTTTTCTACCTTTAAATAGCAAAGTACCACTACCACAACTACCCCTTGCCCCCTCCCCCATCTTTTTTCTTAAAATTCTCTGGCATTTCAGGGCTCAATATGTTTCCTGATTTCTGGAGAACTGGGCAAGGCCTGAAATTCACCCCTCCCCCACCTCTGCTGGGCGGCCCAGGACCCGTTCTGGGAGAGAGCCCCTCATACTGCCTGGGCTCTCAGCCAAGCGGCCTTGGATGGATGAAGTCAGTGAGTGTGGGGGAGAGGGTGAGCTCACTCAGGGCCCCCAGAGGAAGCTCTCCAGCCTCTGCCCTCCCCCTGACACACAGGGCGGGAGCCCGGGCTATTCGTGGCAGCTGTGGCTGCAGCTGTGCTGCTGTACCCTCCCAGAATGTGTGACAGGCCCAAATGTTCCTGGGAGATATCCCATGCGGGGCTTAGAGTCGCTAATTTGGTTCTGTGTTTTGCCTCAAACTGCACAAAGCTCCCCTAAACAACAATTTCGTATGGTGGGGGAGGGACCAATCCAGAGGCCAAGCTGAGTGTCCCTGAAACCATGGCATCTCCAGGTGGTAAGATAGCAGGAGCAGGAGTTAGGGAGTTACCTGCTTAAAGACTGGAGTCTGAGCAGGCCAGTCTGATACATGCTTCCCGAAGGTCTGTGTTGCACTGTGAACACAGTCTCATGCTGTGCCCTTCATTTCACCCAGAGATATTGAC