Transcript asmbl_28836

Sequence
Transcript Sequence for observation asmbl_28836 of TGE0057004:
GCTAGGGGTGCGGGGTTGGGGAGGAGGCCGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGGCACTTCTGCGCAGCGGCGCCCGCAGCCGCAGCCCCCTGCTCCGGAGGCTGGTGCAGGAAATAAGATATGTGGAACGGAGTTATGTATCAAAACCCACTTTGAAGGAAGTGGTCATAGTAAGTGCTACAAGAACACCCATTGGATCTTTTTTAGGCAGCCTTTCCTTGCTGCCAGCCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAAGCTCCTACAAGGCAGGCAGTATTGGGTGCAGGCTTACCTATTTCTACTCCATGTACCACCATAAACAAAGTTTGTGCTTCAGGAATGAAAGCCATCATGATGGCCTCTCAAAGTCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAATGTTCCATATGTAATGAACAGAGGATCAACACCATATGGTGGGGTAAAGCTTGAAGATTTGATTGTAAAAGACGGGCTAACTGATGTCTACAATAAAATTCATATGGGCAGCTGTGCTGAGAATACAGCAAAGAAGCTGAATATTGCACGAAATGAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGAAATGAAGTTATTCCTGTCACAGTTACAGTAAAAGGTCAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTTAGCAAAGTTCCAAAGCTGAAGACAGTTTTCCAGAAAGAAAATGGCACAGTAACAGCTGCCAATGCCAGTACACTGAATGATGGAGCAGCTGCTCTGGTTCTCATGACGGCAGATGCAGCGAAGAGGCTCAATGTTACACCACTGGCAAGAATAGTAGCATTTGCTGACGCTGCTGTAGAACCTATTGATTTTCCAATTGCTCCTGTATATGCTGCATCTATGGTTCTTAAAGATGTGGGATTGAAAAAAGAAGATATTGCAATGTGGGAAGTAAATGAAGCCTTTAGTCTGGTTGTACTAGCAAACATTAAAATGTTGGAGATTGATCCCCAAAAAGTGAATATCAATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTTGGTCATTTGACTCATGCCTTGAAGCAAGGAGAATACGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTG