Transcript asmbl_25971

Sequence
Transcript Sequence for observation asmbl_25971 of TGE0000925:
CGGTGGCCTTGCCTCTGGCTCTGAGGCGGCGGCGCCGGGCGCTGCGAAGGCTCGGCCGCTGTAGTCAGTGGTGTGGGGTGCGCAAGGGCACGGACCTCGGAGCTCTCCCCGCTTGCGCCGAGTTTCTCAGCGCCTTCCCCACCCAAACCGGGGTCTCGCAGTCGGAAGCACTCAGAGTGCAGCCCCGCGCGGGGCCGGTCGTAACCGCGCCGCGGGCCGGACGATGCCCAAGAAGCTGCTGCTGTTGCCCCCGCCCTCCGCGTCCTCGGCTTTCCGCGTCCCGCGCGCCCGCCCCGTTCCCCCGCCGGCCATGAACGCCGCTCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACGGAGCTGGCCAAGCGCATCACAGAGCGCCTTGGTGCTGAATTGGGGAAGTCTGTTGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTCATCATGGCTTACGCACTGAAGACTGCCTGTGCCAGGAACATTATTGGGGTCATCCCCTACTTCCCCTACAGCAAGCAGAGCAAGATGAGGAAGAGGGGTTCCATTGTGTGCAAGCTGCTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGATCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCTGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATTGTAGCTAAGTCTCCTGATGCTGCAAAGAGGGCCCAGTCCTATGCGGAGAGACTGCGTCTGGGTTTGGCCGTCATTCACGGGGAAGCTCAGTGCACGGAACTGGACATGGACGATGGTCGTCACTCCCCGCCTATGGTCAAAAATGCTACTGTGCACCCAGGCCTGGAGTTGCCATTGATGATGGCCAAAGAGAAGCCACCGATAACTGTAGTTGGAGATGTTGGAGGCCGCATCGCAATCATCGTGGATGACATTATTGACGATGTGGAGAGTTTTGTTGCTGCCGCGGAGATCCTGAAAGAGAGAGGCGCCTATAAGATCTATGTTATGGCCACCCACGGCATCCTGTCTGCAGAGGCCCCTCGCCTGATTGAGGAGTCCTCCGTAGACGAGGTGGTGGTGACGAATACTGTCCCTCATGAGGTTCAGAAGCTGCAATGTCCCAAGATAAAGACTGTGGATATCAGTTTGATTCTTTCTGAAGCCATTCGGAGAATCCACAATGGAGAGTCCATGGCCTACCTTTTCCGAAACATCACTGTGGATGACTAGCTTTCACGAGGGTCTCGACCCTGGACCTCCTGAGGGAAACATGGAAAAAGCAGTGCCATGAGTGATACAGTGTTTCCTTGCAAGGGAGGACTCGAAACAGCCTGGAGTTAGATATCTTCTTTTGCCCGGATTGATGGGGAGGAGGGATTAAAAGAGTCAGGAAGAAGACAGAGCTAATGGATAAATATCATAACATGGCCTTACATGTCTGCTGTCATCAGCCCTGTTCCTTAAAAGTTCTAGCTGCTTTCTTAAAAATAATCTGAAAATCTTATTGATACTAAAGAGGAGTTAAAGGCACATAAAGTCTTAACTCTATAATGTTCATTTAGTTGTTTCAGCTCCAGGGAAATGGAGGTATTGATGTTGAACCTGGTTAGGGAAGCTGAGCGCCTGTGGCCCTATTACTATCCAGTTGGCCTCTCCCAAATCAACTTCAAGTCTTTTATAGAGAATCGTATTTTTCTTTCAGAAATTGTTATGCCTACAGCCATTGAAAAATGAAGCATTCATGTTGTTACATCTTCCAAGGATGTCAGATTAGAAAATAGCATCCCACCTCTGGGTATCTGAGTGGCTCTGAAGTTGCAAATAAAATAATTTGTTGTCTTGCTAGTCTTTTCATTAGACAGCAGAAGACCATGGATACAGAACAGCAGTCAGGTCTGTGGCTGGACACAAACACTTTCCCAGGTTCCACCCTCTTCCTAAGTGTTGAAGCTAAATCC