Transcript asmbl_142720

Sequence
Transcript Sequence for observation asmbl_142720 of TGE0059415:
AGGGGAAGGATTCTATTGTCTCTGAGCCTCCTGCAGCAGCTGGGTCTTTGAGGCAGCATAGTAAGTAGATCTTTCTCTGCAGGTAGCCAATGAGACTCACGGGCATGTGGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCATCCGCAAGAAGATGGATCTCATTGACCTAGAGGATGAGACCATTGATGCCGAGGTCATGAACTCTCTAGCAGTTACTATGGATGACTTCCGGTGGGCCTTGAGCCAGAGTAACCCATCAGCACTGCGGGAAACCGTGGTAGAGGTGCCACAGGTAACCTGGGAAGACATCGGGGGCCTAGAGGATGTCAAACGTGAGCTACAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATTCCTGAAGTTTGGCATGACACCTTCCAAGGGAGTTCTGTTCTATGGACCTCCTGGCTGTGGGAAAACTTTGTTGGCCAAAGCCATTGCTAATGAATGCCAGGCCAACTTCATCTCCATCAAGGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAGTCTGAGGCCAATGTCAGAGAAATCTTTGACAAGGCCCGCCAAGCTGCCCCCTGTGTGCTATTCTTTGATGAGCTGGATTCGATTGCCAAGGCTCGTGGAGGTAACATTGGAGATGGTGGTGGGGCTGCTGACCGAGTCATCAACCAGATCCTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTCATCATTGGCGCTACCAACCGGCCTGACATCATTGATCCTGCCATCCTCAGACCTGGCCGTCTTGATCAGCTCATCTACATCCCACTTCCTGATGAGAAGTCCCGTGTTGCCATCCTCAAGGCTAACCTGCGCAAGTCCCCAGTTGCCAAGGATGTGGACTTGGAGTTCCTGGCTAAAATGACTAATGGCTTCTCTGGAGCTGACCTGACAGAGATTTGCCAGCGTGCTTGCAAGCTGGCCATCCGTGAATCCATCGAGAGTGAGATTAGGCGAGAACGAGAGAGGCAGACAAACCCATCAGCCATGGAGGTAGAAGAGGATGATCCAGTGCCTGAGATCCGTCGAGATCACTTTGAAGAAGCCATGCGCTTTGCGCGCCGTTCTGTCAGTGACAATGACATTCGGAAGTATGAGATGTTTGCCCAGACCCTTCAGCAGAGTCGGGGCTTTGGCAGCTTCAGATTCCCTTCAGGGAACCAGGGTGGAGCTGGCCCCAGTCAGGGCAGTGGAGGCGGCACAGGTGGCAGTGTATACACAGAAGACAATGATGATGACCTGTATGGCTAAGTGGTGGTGGCCAGCGTGCAGTGAGCTGGCCTGCCTGGACCTTGTTCCCTGGGGGTGGGGGCGCTTGCCCAGGAGAGGGACCAGGGGTGCGCCCACAGCCTGCTCCATTCTCCAGTCTGAACAGTTCAGCTACAGTCTGACTCTGGACAGGGGGTTTCTGTTGCAAAAATACAAAACAAAAGCGATAAAATAAAAGCGATTTTCATTTGGTAGGCGGAGAGTGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCATTTCTGTTGTAGTTTGGGGCAGTGCAGGGGACCTGTGTGGGGTGTGAACCAAGGCACTACTGCCACCTGCCACAGTAAAGCATCTGCACTTGACTCAATGCTGCCCGAGCCCTCCCTTCCCCCTATCCAACCTGGGTAGGTGGGTAGGGGCCACAGTTGCTGGATGTTTATATAGAGAGTAGGTTGATTTATTTTACATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAAATGACATGTTGTAAAAGGACAATAAACGTTGGGTCAAAATGGAGCCTGAGTCCTGGGCCCTGTGCCTGCTTCTTTTCCTGGGAACAGCCTTGGGCTACCCACCACTCCCAAGGCATTCTTCCAAATGTGAAATCCTGGAAGTAAGATTGCACCTTCTTCCTCTCCTGATCAACATCGGTATGATGTCTCCTGTTGCCTCACCCTTTGTCTGCAGTATCACTGGATAGGACTGGTGGAAAGGGAGCAGCCTGACAGAGCTCCAAATGTGGAGAATATGGCATCCCTCCACCTATATTTGATGTGGACGGTAAGGCTAGGCCTGCAGGATCCCTTATCCTGACCAAAGACTGTGTTGGGGTGCCATTTGAAAATCGCAGGGTTGCAAAAGAATACAATCTTACTTGCAGGTGGATATTCTCTATACTCTCTTTTAATGCATCTAAAAATCCCAAACATCCCCTGGTTGGTGATCACTTACAGTTGTGTCCACCTTTATTTTATGTACTTTGATTAAAAAAAA