Transcript asmbl_14205

Sequence
Transcript Sequence for observation asmbl_14205 of TGE0058251:
AACACAAGCACGCACACACCACTGGGAGATCAGATCTTCTAGCTGGCTCTCTGCTGCCACAGCTCCGCCGAAGGGAGGGGGTGGAAGAGGAGGACTAAACTCAGAGCTGAGAGGAGAGGCAGGTGTGTGCAGGTGCATCACCTGGATCATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGCCAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCCAGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCTCCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCCCCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATCCCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAGTCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAGATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAACCAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAGAACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTGGATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTCAAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTCCCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGATACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGACAGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCACAACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAACAATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCATGACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAACTACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTGGTCATCTAGGCCCTACTCCGCCACCGGATCTGCTCTGACCGCACTTGAAGGCTGGGGCCCAGGCACCTGTGCCGGCCATTCGTTTTCTCTCTCTCCCTTTCTTTCTCCCAGCTTTGCCTCCCTTATCCCACCCTCGAGGCAGGGAAAAGCCATCTATTCTTCTGCAGCCTCAGGAGCGAGACTTCAAGGACTCAGTTTGGTTCCACCCAGTTGAAAGACACCCAGTGCACACCCAAACTCCTGGCCTTCTGTGGTTTCCCTTTGCTCCAGAAACACAGATGTGTCTAAAGACTTGGTGTCCCCTTCTCTCTCCTCCCCCACCCGCCACTCCTGGGTACATCTGGGCCGTGGACTATCTGATCTTGGTCCTGGCCGAGCAAACAGCCCGGAGGTAAGGTTCAGAAAGTCCCCCTGGGGACTCCTCCATCTTCGGCAGCTCTGGCTCAAAGAGGCCGAGAAACCCAGTTCTCCTGGGCCAAGGATCCCTTCTGGCAAAGCTGCTGCTCCGCCGCTTGGTTCCCCGGCACCAGACATCGCCCTGGCCCTGCTGGCCCGGGTATCGGGAAGGAGGAGCGAGGGAATGACGGAGGTAGGGTGCAGGGTCAGGGCTCCCGCAGGGGCCTGCATCTGGCCAGCAGGACACAGGGATGCGCAGGGCGCCCCCTTCTGTTCCAGGGTGAACATAGCACACGCCCTCCTGGCTGGGCCTCAGGAGGAACAGCCAAGGAGAAGAATGGCCCAAGGAACTAGGAAGCAGCCATGGGAGAGGGGAAGGGTTCAAGCCCGGGATGGGCCCGCGTGACGTCGATGGGTCCTGCGGCCCCCTTGCCCAACCTCGGGTTTAGGGAGGAGGGTTCACAGTGTTTTTGTGGGGGCGGGGGAAGGAAGAGGCAGCCCCGCCCCCGCCATCTGTTCTCCATCAGTGTGCGCGGCCCAGCCATTTCCACCCTCGGGAGGCGGCTCCTGAGAAACAGGGAGGAAGGGGCGGAGCACCTGGACGTCTCCCAGAAGCCCCTCCACGTTTGAAAATGCGCCTCCTCCTCGGAGACAGACGCATCGGTGCCACCTAGTGGCTGGTGGGAGTAACAGCTGGTCCCAGTCTTGCGCCTGGCCCTCTTCCTGGGGTGATTTTCCTCGGTGGAGGAGGCCCGTGGGGTCCCAACACGGAAGAGCCATGGGCCGTGTGCATGGTGTCGCTCTCCTCTAGGGTCTAGCGGGCACAAACGTCCCCAGGCTGGGCTCATTCCCATCGTGAGTGAGCCCAGGTGAGGACATAGTCGGCTCCCGTTTGTTGTAGGCCCTTCCCAGGTGCCTTCTCAGCTCCCTCATCTGTAAACCGAGGAGGTGGATAAGATGCTCCCGGCCGGGCGC