Transcript asmbl_105767

Sequence
Transcript Sequence for observation asmbl_105767 of TGE0056378:
CGGGCAGGGCCGGGGTGGGGCCGCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCGGGGTTTCGGGGCACTTGGGTCCCACAGTCTGGTCCTGCTTCACCTTCCCCTGACCTGAGTAGTCGCCATGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATCCTGACTCTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAAGACTCTGTTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGAAAAATTAATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACATGCCTTGAAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGTATTGCGTGGAGATTAATTACAGTTTGATTAAAAAGCCTGAAGTTGGACTGGGCTGAATCTAGTTAAGTAAGGTCACTTAAAATTCTTTTAATAATTTGTGGTACTTGCTGATTCTTACTGCGATGATTCTGACTGTATGTTGCCTGTGCTTGTTTGTGTTTCAGAATATCTGGTCTAAATTCTTAACAGCTAACTCATACATGTTTTAGATAGTAGTATCTTGTTCCTTTCATAGAATGATAGCGGTATCTTGTTCTTTCATAGAATTTAAAATCAGTAGGGTCATTATTGGTTTTGGACAGTGCTGGGTGATGATAACGTGAAATAGTGCAGGATTGATCTTAATAAAAGCATATTATTCCTAGAGAAAGAGTGTTATTGAATAACCATCAGGTGGAACCATTTTTCCTTTTGAATGAGAATGCTCTATAGTTCAGTAATGTGACATATTACCTCTCATAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTGTGAAATCTATTCGAAGTATACCTGCCTACCTTGCAGAGACCCTCTATTATGCTATGAAGGGAGCTGGGACAGATGATCATACCCTCATCAGAGTCATGGTTTCCAGGAGTGAGATTGATCTGTTTAACATCAGGAAGGAGTTTAGGAAGAATTTTGCCACCTCTCTTTATTCCATGATTAAGGGAGATACATCTGGGGACTATAAGAAAGCTCTTCTGCTGCTCTGTGGAGAAGATGACTAACGTGTCACGGGGAAGAGCTCCCTGCTGTGTGCCTGCACCACCCCACTGCCTTCCTTCAGCACCTTTAGCTGCATTTGTATGCCAGTGCTTAACACATTGCCTTATTCATACTAGCATGCTCATGACCAACACATACACGTCATAGAAGAAAATAGTGGTGCTTCTTTCTGATCTCTAGTGGAGATCTCTTTGACTGCTGTAGTACTAAAGTGTACTTAATGTTACTAAGTTTAATGCCTGGCCATTTTCCATTTATATATATTTTTTAAGAGGCTAGAGTGCTTTTAGCCTTTTTTAAAAACTCCATTTATATTACATTTGTAACCATGATACTTTAATCAGAAGCTTAGCCTTGAAATTGTGAACTCTTGGAAATGTTATTAGTGAAGTTCGCAACTAAACTAAACCTGTAAAATTATGATGATTGTATTCAAAAGATTAATGAAAAATAAACATTTCTGTCCCCCTG