Transcript asmbl_26325

Sequence
Transcript Sequence for observation asmbl_26325 of TGE0004497:
GGTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGGTAGTAGCATTTTCATTACAGTGACTAAAATTTCAGCACTTTACCCCAATCATGTGGCAGGAGTACTGGCTATTATTGAAACTTGTTCAGTTCCAGCCAAAGTTGGGGGAGGTGATGTACATTTGAGAAGTCATATGTTTGTTTAGAAGTAGGTGTGATAACACTTAAAAATTCTAAGTCAGTTTAGAAGCCTCACACCATTGAAGTTATTACAAGTTTTGGATTTTTGGCATGTCTTTGGGTCTCATGTTGCTTAACTCAATCCCCGCAGGACGTTAAAGCTATCTGGAGCAGTTTTTATCTGGGATTCAAAGTTGTTATTGAAGAAGCATTCTCTTCTAGTTAGAAAATGAATTTGATTCAGAAGCCCCTAAAGACATGGGTACTTAGCAATGAAATAGTAAGTAGGCGTTAATTAACTGCCATTTTTCTCTTACAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACAGTTGTCTGTCCTTGTTTGGGTTAGGGTGTTGATGTAGGCTTCATTTTAAGCAGCAGCAGGTTCTAAGCCACGTGCTATGTTTGCTTAATTCCACAGAGTACTGTGTTTTGCTTCCCTGACCCAAGAATTAAATGTCACTGAGTATCTTCAAGGTAATCTGAGTGGAATACCGAAGGTGAAACGGGGACCAGGTTGGGCCAGTGCTCCTTGAAGAAAGTCCCACTTGGCATGTT