Transcript asmbl_26324

Sequence
Transcript Sequence for observation asmbl_26324 of TGE0004497:
GGTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACAGTTGTCTGTCCTTGTTTGGGTTAGGGTGTTGATGTAGGCTTCATTTTAAGCAGCAGCAGGTTCTAAGCCACGTGCTATGTTTGCTTAATTCCACAGAGTACTGTGTTTTGCTTCCCTGACCCAAGAATTAAATGTCACTGAGTATCTTCAAGGTAATCTGAGTGGAATACCGAAGGTGAAACGGGGACCAGGTTGGGCCAGTGCTCCTTGAAGAAAGTCCCACTTGGCATGTT