Transcript asmbl_59813

Sequence
Transcript Sequence for observation asmbl_59813 of TGE0001130:
CTCTGCCCCACAGCCACAGCCCCTGACTGCCGCAGCCCCCACAGAGCCCGCCGCGCACCCCACGTCCCCCACGCCAGCGCCCAGCCATGGAGGCCATCAAGAAGAAAATGCAGATGCTGAAGTTGGACAAGGAGAATGCCATCGACCGCGCGGAGCAGGCGGAGGCGGATAAGAAAGCCGCTGAGGACAAGTGCAAGCAGGTGGAGGAGGAGCTGACGCACCTCCAGAAGAAACTAAAAGGGACAGAGGACGAGCTGGATAAATATTCCGAGGACCTGAAGGACGCGCAGGAGAAGCTGGAGCTCACGGAGAAGAAGGCCTCCGACGCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGACAGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCAGATGAGAGTGAGAGAGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGAGATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAGGTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAGGTGTCTGAACTAAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGAGGCTGCATCTGAAAAGTATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGAGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACACTAAACGAACTTAACTGTATATAAGCAAAACAGAAGAGTCTTGTTCCAACAGAAACTCTGGAGCTCCGTGGGTCTTTCTCTTCTCTTGTAAGAAGTTCCTTTTGTTATTGCCATCTTCGCTTTGCTGGAAATGTCAAGCAAATTATGAATACATGACCAAATATTTTGTATCGGAGAAGCTTTGAGCACCAGTTAAATCTCATTCCTTCCCTTTTTTTTTCAAATGGCACCAGCTTTTTCAGCTCTCTTATTTTTTCCTTAAGTAGCATTTATTCCTAAGGTAGGCAGGGTATTTCCTAGTAAGCATACTTTCTTAAGACGGAGGCCATTTGGTTCCTGGGAGAATAGGCAGCCCCACACTTTGAAGAATACAGACCCCAGTATCTAGTCGTGGATATAATTAAAACGCTGAAGACCATAACCTTTTGGGTCAACTGTTGGTCAAACTATAGGAGAGACCAGGGACCATCACATGGGTAGGGATTTTCCATCCAGAGCCAATAAAAGGACTGGTGGGGGCCGGGGGTGGCTATTGTGGGAAGTCATAACCCACAGATAGATCAACCTAAGAATCCTGGCCCTTCTCCACTCTCCACCATGCAGGACAAACATCTTCTCAAGCAGTCAACGTAGAATGCTTGGGAAATAGTCATAATTACCCACATATAGTAATTAATAGATGGTAATTAATTGATCCTTGATGTGATGTTCTTTTGCATATTTCCTTCATTCTAAAGTTGTTCCCTGGCCGGGAGCGTTGGCTTTCGCCTGTAATCCCAACACTTTGGGAGGCCAGGACAGATCACTTGAGGTCAGGAGTTCGAGACCAGCCCAGCCAACATGGCGAAACCATGTCTCTACTAAAAATAC