Transcript asmbl_43913

Sequence
Transcript Sequence for observation asmbl_43913 of TGE0000584:
CACGAAGGGGACGTGGGAAAGTGTTAGCGGGGAACGCTGGGAAACTCCCGGCCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAGCTACTAACCAGAGCCGGCTCTTTCTCGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGTTAAAGCCACAGCTGCGCCTGCAGGAGCACCGCCACAACCTCAGGACCTTGAGTTTACCAAGTTACCAAATGGCTTGGTGATTGCTTCTTTGGAAAACTATTCTCCTGTATCAAGAATTGGTTTGTTCATTAAAGCAGGCAGTAGATATGAGGACTTCAGCAATTTAGGAACCACCCATTTGCTGCGTCTTACATCCAGTCTGACGACAAAAGGAGCTTCATCTTTCAAGATAACCCGTGGAATTGAAGCAGTTGGTGGCAAATTAAGTGTGACCGCAACAAGGGAAAACATGGCTTATACTGTGGAATGCCTGCGGGGTGATGTTGATATTCTAATGGAGTTCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGTTGGGAAGTAGCTGACCTTCAGCCTCAGCTAAAGATTGACAAAGCTGTGGCCTTTCAGAATCCGCAGACTCATGTCATTGAAAATTTGCATGCAGCAGCTTACCGGAATGCCTTGGCTAATCCCTTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAGGAGTTACATTACTTCGTTCAGAACCATTTCACAAGTGCAAGAATGGCTTTGATTGGACTTGGTGTGAGTCATCCTGTTCTAAAGCAAGTTGCTGAACAGTTTCTCAACATGAGGGGTGGGCTTGGTTTATCTGGTGCAAAGGCCAACTACCGTGGAGGTGAAATCCGAGAACAGAATGGAGACAGTCTTGTCCATGCTGCTTTTGTAGCAGAAAGTGCTGTCGCGGGAAGTGCAGAGGCAAATGCATTTAGTGTTCTTCAGCATGTCCTCGGTGCTGGGCCACATGTCAAGAGGGGCAGCAACACCACCAGCCATCTGCACCAGGCTGTTGCCAAGGCAACTCAGCAGCCATTTGATGTTTCTGCATTTAATGCCAGTTACTCAGATTCTGGACTCTTTGGGATTTATACTATCTCCCAGGCCACAGCTGCTGGAGATGTTATCAAGGCTGCCTATAATCAAGTAAAAACAATAGCTCAAGGAAACCTTTCCAACACAGATGTCCAAGCTGCCAAGAACAAGCTGAAAGCTGGATACCTAATGTCAGTGGAGTCTTCTGAGTGTTTCCTGGAAGAAGTCGGGTCCCAGGCTCTAGTTGCTGGTTCTTACATGCCACCATCCACAGTCCTTCAGCAGATTGATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCAGAGCAGCAAACACATGAAAGTCAGAAGTCTCTAATATATCATTTGTCTTTTTTCCAGTGAGGTAAAATAAGGCATAAATGCAGGTAATTATTCCCAGCTGACCTAAAGTCAATAAAACATTCTGTTTAAGTGTTTTTCTTACGTTTTTCTCAATGAGTTAATCAACAAGTATTTATTATGTGCTGATATCTTTGTTTTAGATGCTTTAAAGGAGACAGGAATATAATTATTGAGTATAGAAGCATCAGAAACTATTAAAATTAAGGCTAAGTGGCTATCGGGGTAAATAGTGCCAGATTACTATTGGTGGCGTTTAAGATGAAAGCAAGTTCAAAATTTGTCATTTTGGGTGTCAACAGCTAAATGGTCTGGTTTTTACCCCTGTTTTGCCTTTTTTGCAATAAAATTATTTCCAAAAAACATACATTTCCTATCAATCATAT