Transcript asmbl_42872

Sequence
Transcript Sequence for observation asmbl_42872 of TGE0000524:
GCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGTAATCTACACTGTTCAGTACAGGTAGCTACGGAGCATCTGAAATATGGCTAGAAACTACATTTTTGTTTTGATTAATTTAAATAGCCATACAGTTGCTACCATACTGGTCACGGCAGCTGTAGACTGACTGGGTCCATAGTTCATCACCTCAAAATTCTTTCAAAATTTATTATCTCTTTCTCTCCTTACATGTTTATTTCCCAGGCCTACCCTGGTGATTAGAACAGCTGAAGGGCCTTTCTTGTTAGGCTGTCCATGCCCTAAGGATGGGTTCCTGTTTATCCTTGCCACGCAGCTGAGCTTACTGCATGTTTATATCTCCCAAGGACTGTTCTCTGCTCAGAAATGCCCTGTCAAGGGTGTGGCATCACGCAGTTTCATCCAAGTTGTTTCAGGAATTGCTGACACTGCTGGGTGCAGTTCTATCCCCTAAAGCCTAGGGTGTGGCCCTTTAACTTCCCCTTCAGTAGAACTGGGAAAGGCAGTACCATTCCTAGTTATGAGTGAAGCATCCACTTTCTTTTGTAACAATGAGGAACAGAAAGGATAAGACTGAAGAGTGATCTTTTGTCCAACTAAACCATTTATCTCCTTTTGTAGGTAAATTCAAATCCTGCCCAGTTATAGTTTTCAGTCACTGGAGAATTCCAGGTAGGAGCCCTACTTTAGGTGATCCTAGGAACTCCTATGTTCAGAAAAGAATTTTCTTCCTACTATATAATTACAGTATTTAGCTGTCAATTTTAAGATGAATTTGGTAGAGCCTTATAGTAAAGTATGTATCTTGGTCACACACAAAGCTTGGAAAAAGTAAAAGATGTCTAAACCATAATCTTGTAACTCATAACATCTGGGCTGGGGCCCGGGGATCTAATTGTTTAGAGAGCCCCAAAAGTGGCTCAGATGTAAAGCCAGGGTTAAGAACCATCTGCCTTGGAAGATTTAAGGGAAACATATAAACTTGTACAAAGGACACAGAAGCAGTCAGTTTTAATTTTTTAGCCATGTTGGTAAAAGTTCATTTTCAGTACATGGGTAACACCCAGGCCCTTTCCCATTATATCCAGGTATGCTACAAGTTCTTTTAACTCTTATCAGAAGTTATTATTACTGTTTCCTTAGAGAGGCTACCAGGCTAAAATTCACTTAGTTTGGTTTGTCTAATGTCCTCATTATTTTATCCTGAAGATGATGTCATTTCTCAGGACTTGAAAATGACTTGGCTGAACTAAAGGTAAAAAAGCCAAGCCTCTGTCACTTTTCCTAGACTCCTAGGCACAGCTATGGAGTCTTTGCACAGTGCCCATACCCTAAAAATTAATAATGAAAACCAAACCTCAAGAACCTAGAGCAGCTCTCTACTTGCCACCATGGACTCCAGTGGTCAGCATAAGAAAAGCAGATAGTTGCATTCTATTTAGTTTATAGCTGCTTTGTTCCTTTGTGTTTCACTAAGCAGAGGCTCAAAAATTCCCTTGATAACTTCAGCTGCCCCTGTTCTTTTCCTCAAACTCCAGGATGAGACCTTTAATGTGGGACAATTTCTGGTGAAGGTACTCACAGCGACGCTTTTCTTC