Transcript asmbl_39815

Sequence
Transcript Sequence for observation asmbl_39815 of TGE0000491:
CCCCATTGGTCATCAGGTTTCTTAAAATGTGACTCTGAATCTGTGTCCTTCCGCCGCAGAATTTAGTCCCACCGAAAGGGCAACCTGCCCGCGCGTTCCGCCGCCGCCGCCGCGCTTCCTCCTGAAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGATGGACCCCAGAGCCCCTCCTCCAGCCCCTGTCCCACCCCCTTCCCCCAGCCCATCCATTAGGCCAGCAACGCTTGTAGAACTCACTCTGGGCTGTAACGTGGCACTGGTAGGTTGGGACACCAGGGAAGAAGATCAACGCCTCACTGAAACATGGCTGTGTTTGCAGCCTGCTCTAGTGGGACAGCCCAGAGCCTGGCTGCCCATCATGTGGCCCCACCCAATCAAGGGAAGAAGGAGGAATGCTGGACTGGAGGCCCCTGGAGCCAGATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAAGAAACAGCCAGCAAGAGTTAGGGGCCTTAGGGCACTGGGCTGTTGTTCCATTGAAGCCGACTCTGGCCCTGGCCCTTACTTGCTTCTCTAGCTCTCTAGGCCTCTCCAGTTTGCACCTGTCCCCACCCTCCACTCAGCTGTCCTGCAGCAAACACTCCACCCTCCACCTTCCATTTTCCCCCACTACTGCAGCACCTCCAGGCCTGTTGCTATAGAGCCTACCTGTATGTCAATAAACAACAGCTGAAGC