Transcript asmbl_39779

Sequence
Transcript Sequence for observation asmbl_39779 of TGE0056539:
CAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTACTCCGAAAAGGGGGAGTCATCTGGCAAAAATGTCACTTTGCCTGCTGTATTCAAGGCTCCTATTCGACCAGATATTGTGAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTCATCAGACTAGTGCTGAGTCTTGGGGTACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTCGAGGTGGTGGGACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACATGTGTCGTGGAGGCCGAATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCATCGTAGAGTGAACACAACCCAAAAACGATACGCCATCTGTTCTGCCCTGGCTGCCTCAGCCCTACCAGCACTGGTCATGTCTAAAGGTCATCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTAGTTGAAGATAAAGTTGAAGGCTACAAGAAGACCAAGGAAGCTGTTTTGCTCCTTAAGAAACTTAAAGCCTGGAATGATATCAAAAAGGTCTATGCCTCTCAGCGAATGAGAGCTGGCAAAGGCAAAATGAGAAACCGTCGCCGTATCCAGCGCAGGGGCCCGTGCATCATCTATAATGAGGATAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGAATTACTCTGCTTAATGTAAGCAAGCTGAACATTTTGAAGCTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAGTGCTTTCCGGAAGTTAGATGAATTGTACGGCACTTGGCGTAAAGCCGCTTCCCTCAAGAGTAACTACAATCTTCCCATGCACAAGATGATTAATACAGATCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGCACCACGCAAGAAGATCCATCGCAGAGTCCTAAAGAAGAACCCACTGAAAAACTTGAGAATCATGTTGAAGCTAAACCCATATGCAAAGACCATGCGCCGGAACACCATTCTTCGCCAGGCCAGGAATCACAAGCTCCGGGTGGATAAGGCAGCTGCTGCAGCAGCGGCACTACAAGCCAAATCAGATGAGAAGGCGGCGGTTGCAGGCAAGAAGCCTGTGGTAGGTAAGAAAGGAAAGAAGGCTGCTGTTGGTGTTAAGAAGCAGAAGAAGCCTCTGGTGGGAAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAGTGAGAAACATGACTTGGTGTGCTCTGTAAAGCTTGGTTAGAATTTTTTTAAAGTGACATTTTGTTGGCCATAATTTAGACTGTTACATTTTATATAGTGTGGTATAAAATGGGGCATGGATTTATACTAAGTCCATGGAGTTCAGTGGAAGGGGAATGATTTAAAAAAAGTTGTGGTTTTCTAAATAATGTGGCTTGAAAAATAGGTGTAACAGGACTTGGTCAGAAACGCAGAGGCTGTTCAAGTTTAGCTCCCCACCAGATGGAAAATAGGTTAAATTCTGTAAAGATTTAACTTTAACCACAAGAGGGCACAACTGGAGAGCACAATTTTTTTGGTACTGCAGTAAAATTGATTACCTCTTGAGAAGTGTTCTTTTTAACCAGCTATAACAATAGAGTTGAGTATTTTCACCCATGGTTTGAAAAAGTGCCAGAAGGCCACACTGGCCCACATCTGTAATCCCAA