Transcript asmbl_38932

Sequence
Transcript Sequence for observation asmbl_38932 of TGE0056213:
GTTCGGACCAGTGATTGGCTGGAGAAAATAGTCCTCCCCACCAATGAGGAAGCCTGGCAGGATGGAGGGCGAGGCCTGGCAGCTGTAGTGCTTCTGGGCAGTAGAGGCGCGGGGTGCGGAGCTAGGGCGGCCGAGAGCCATGGCGGCGCTATTGGCGGCGGCGGCAGTGCGAGCCCGGATCCTGCAGGTTTCTTCCAAGGTGAAATCCAGTCCCACCTGGTATTCAGCATCTTCCTTCTCTTCTTCAGTGCCAACTGTAAAGCTCTTCATTGGTGGGAAATTCGTTGAATCCAAAAGTGACAAATGGATCGATATCCACAACCCAGCCACCAATGAGGTCATTGGTCGGGTCCCTCAGGCCACCAAGGCAGAAATGGATGCAGCCATTGCTTCCTGCAAACGTGCTTTTCCTGCATGGGCAGACACTTCAGTATTAAGCCGCCAGCAGGTCTTGCTCCGCTATCAACAACTTATTAAAGAAAACTTGAAAGAAATTGCCAAGTTAATCACATTGGAACAAGGGAAGACCCTAGCTGATGCTGAAGGAGATGTATTTCGAGGCCTTCAGGTGGTTGAGCATGCCTGTAGTGTGACATCCCTCATGATGGGAGAGACCATGCCATCCATCACCAAAGACATGGACCTTTATTCCTACCGTCTGCCTCTGGGAGTGTGTGCAGGCATTGCTCCATTCAATTTTCCTGCCATGATCCCCCTTTGGATGTTTCCCATGGCCATGGTGTGTGGAAATACCTTCCTAATGAAACCATCTGAGCGAGTCCCTGGAGCAACTATGCTTCTTGCTAAGTTGCTCCAGGATTCTGGTGCCCCTGATGGAACATTAAACATCATCCATGGACAGCATGAAGCTGTAAATTTTATTTGCGATCATCCGGACATCAAAGCAATCAGCTTTGTGGGATCCAACAAGGCAGGAGAGTATATCTTCGAGAGAGGATCAAGACATGGCAAGAGGGTTCAAGCCAATATGGGAGCCAAGAACCATGGGGTAGTCATGCCAGATGCCAATAAGGAAAATACCCTGAACCAGCTGGTTGGGGCAGCATTTGGAGCTGCTGGTCAGCGCTGCATGGCTCTTTCAACAGCAGTCCTTGTGGGAGAAGCCAAGAAGTGGCTGCCAGAGCTGGTGGAGCATGCCAAAAACCTGAGAGTCAATGCAGGAGATCAGCCTGGAGCTGATCTTGGCCCTCTGATCACTCCCCAGGCCAAAGAGCGAGTCTGTAATCTGATTGATAGTGGAACAAAGGAGGGAGCTTCCATCCTTCTTGATGGACGAAAAATTAAAGTGAAAGGCTATGAAAATGGCAACTTTGTTGGACCAACCATCATCTCGAATGTCAAGCCAAATATGACCTGTTACAAAGAGGAGATTTTTGGTCCAGTTCTTGTGGTTCTGGAGACAGAAACATTGGATGAAGCCATCCAGATTGTAAATAACAACCCATATGGAAATGGAACTGCCATCTTCACCACCAATGGAGCCACTGCTCGGAAATATGCCCACTTGGTGGATGTTGGACAGGTGGGAGTGAATGTCCCCATTCCAGTGCCTTTGCCAATGTTCTCATTCACCGGCTCTCGATCCTCCTTCAGGGGAGACACCAATTTCTATGGCAAACAGGGCATCCAATTCTACACTCAGTTAAAGACCATTACTTCTCAGTGGAAAGAAGAAGATGCTACTCTTTCCTCACCTGCTGTTGTCATGCCTACCATGGGCCGTTAGAAACAAGTTTGTTTAAGACTGACTCCATCCTGAGTAATCTCCCTTTATTTTTGACCAGCTTCATTTGTCAGCTTTGCTCAGATCAGATCGATGGGATTGGAATACATTGTAACTAAAATCTTCCTCAGGACTATTAACCCCCGCAAAGTTTCTATAGGGAACTGCCTAGTGTAACAATGAAACCAGATTTCTCACTTGCTCTTCATACTTCTATTTTGAGGTAACTGTTGTAACTATGAAATGCTTATCTGAAAGTAGTGCTTAAACCTGATTTCTAAAAATTATCCCATTTTCTGATGATTTGAAGGGGAGAAAAGCCAGTGTATGTAAAGAAAATGTTCCAGCCAGGCGCGGTGGCTCACGCCTGTAATTCCATCATTTTGGGAGGCCACAGTGGGCAGATTGCTTGAGCCCAGGAGTTGAAGAACGTGGCGAAACCCCGTATCTATTATTTAAAAAAATTGAAAAAGTAAAAAAAGAAAAGGGAAAAAAAATTTTTTAAAGAAGATGTTCCAATAATTGCAAGAAGAACTCTTAGATGGGGAAACAGGACAGAAATAACTCACCGCTTTTGGTTGATCCTCAAACATAGCGCTACCTAAATGCCACTGGGAGAGACCTCCTGCAAAGTTTTCTTTAGCCCCTCTTTTATCCCACAATACACAAGATATAATCCATTTTTATATATCCCAAAGTTGTGGCAACAGCTTCTTTCTTTTCTGCTCAATGCCACTTTGTTTCCTAGTAATTCATGACCACTATTAATTCTATCATTGTCACTGCTCCTGCTTAAGATCACTTCTCAAGGATACCTCAGTAAGCAATGGATAAATCAACTTTTTGTTATATGTGCCAAGTACTAAGTTTCAGGGTTCTCTTCAGCAATCATTAATTAATACTTCAGCCATTAATTCAGATGCAAATAATTTTCTTTTTTCTTTTTTTTGAGATGGAG