Transcript asmbl_31293

Sequence
Transcript Sequence for observation asmbl_31293 of TGE0059314:
GTGAGTAGCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAGGCGTGTGGAGAGACCGCCAAGGGCTGTAGTCTGGACAATGCAGATCTTCGTGAAGACTCTGACTGGTAAGACCATCACCCTCGAGGTTGAGCCCAGTGACACCATCGAGAATGTCAAGGCAAAGATCCAAGATAAGGAAGGCATCCCTCCTGACCAGCAGAGGCTGATCTTTGCTGGAAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCT