Transcript asmbl_25495

Sequence
Transcript Sequence for observation asmbl_25495 of TGE0000090:
TGAGGGGCGGGAGACGCCTGCGTGCGTGCGGCCCGGGGGAGCGCCGAGCAATCTGGGGGTGCGCGAGGGAGTAAGAGGGGCGAGGGGACCCTGCGAAGCGTTGGGTGCCGAGCCAGAGCCTACAAATTGGAGTCCTCGGCACTTTGGGGGCCGCTGGAGGGTTTGGAATCGAGAGCCCAGGGCTAGCCAGTGATGGTGCCAGCTGAGGGCTAGGGCGGAGATCGGAGCCGGGTTGGGAGTCCGTGCACTCGGAGGACTGGGAAAAAGTGCAGGGACCCCTAAAAGGTGGTGGTGGCAGATACGAGACTAGGTGCTGTGTAAAGGGGGCTGGGGGCAGAGAGCAGAGCCTCTGCGGAAAGAAACAGAGGAGGAAGGAGATGGGTCTGGTGCCTCTTCCCGCAAGGGTAGGGAGGATAGGCCGGCCTCGCAGTTCCAGGTCACTTCCGTTCTGGGGTTGAGGCTCAGGGGCAGCGGTGATTGGTGGCCCAGCCTCCTCACAGGCTTGCTGAGGGAATTTGAGCTTCCGGTGGTGGGAAAGGAGGTGAAATCGTCTCGACTCCTGGGGTCCGTGTGCTCTGGTAGAAGTGGGCGACAGTGGCTCAATTTCTGATCAGCAGCTTGCAGCCTAGATGATGGCAGCCAAAGGAAAGACTTGGCCAGCGAGGCTCCCTACCACTCCGAAAAAAGAGAGTGGGGGTCAGCAGGGTCTGCTCTGCTCTGGGGATTAAGGGGCTGACTAGAAGGATTTGAGTCTTTCCTTCTGTCCACTGCCACAGGGTTCTTGGAGTAACTGCAGGGTTTAAACTGCAGGGTCTAACTTCCAGAGGCTGGGGTTCCCTGCCCCCCAGCTTAGAGACATTCCTGAGGTGGCTGAAGAGCAGGAAGGAGAATGAATGCACTTCCAGACTGGCCCAGAGTCTCAGCCCCTCCTCTTCCTTGTTTCCCGCTGGTCCCTCTGGGCTGTACGGCCCGGATGGAGGCCTGAGGAAAATGAGGGGGCTTTGGTTCTCCGGAATTCCGGCCGGGGCCACACCCTCCTGTCTTCAGATGGTTCATGTACCCATCCCCCCTTCCCGTCCTCTCCTTTGTCTCCTCTGTCACCGGGACTCCCAGCAGAGATTTTTTTTTTGTACTGGCTGTGTAACAGGACACCGCATGCAGCCCTCAGGAGGGGCTCTGTGCTTCTGTGAGGAAGGACCCCTGTGCTGGGAAGGCAGACCCCTGTTTATCCCGAGGGACCTGGGGTGACCCCCTGCCCTGGCCTTGTTTCTCCCATTTTACAGTGAGGTGGTCGATCTCCAAGGTCCCTGTAGATTGGGGACTGGTTGTGCCCTCTGCGCCAGGGGCCTCCTCACCATCTCTCCTTTGCCGGCTCCCGCCCTCTTCACTCTTCTGTTTTCTTTCAGAATGAAAAAGGCAGGCATTGACCTCCCTCTGAGGCAGTTTCCAGGCCCACCGTGGTGCACGCAAACCACTTCCTGGCCATGCGCTCCCTCCTGCTTCTCAGCGCCTTCTGCCTCCTGGAGGCGGCCCTGGCCGCCGAGGTGAAGAAACCTGCAGCCGCAGCAGCTCCTGGCACTGCGGAGAAGTTGAGCCCCAAGGCGGCCACGCTTGCCGAGCGCAGCGCCGGCCTGGCCTTCAGCTTGTACCAGGCCATGGCCAAGGACCAGGCAGTGGAGAACATCCTGGTGTCACCCGTGGTGGTGGCCTCGTCGCTAGGGCTCGTGTCGCTGGGCGGCAAGGCGACCACGGCGTCGCAGGCCAAGGCAGTGCTGAGCGCCGAGCAGCTGCGCGACGAGGAGGTGCACGCCGGCCTGGGCGAGCTGCTGCGCTCACTCAGCAACTCCACGGCGCGCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGCGCAGCAGCAAGCAGCACTACAACTGCGAGCACTCCAAGATCAACTTCCGCGACAAGCGCAGCGCGCTGCAGTCCATCAACGAGTGGGCCGCGCAGACCACCGACGGCAAGCTGCCCGAGGTCACCAAGGACGTGGAGCGCACGGACGGCGCCCTGCTAGTCAACGCCATGTTCTTCAAGCCACACTGGGATGAGAAATTCCACCACAAGATGGTGGACAACCGTGGCTTCATGGTGACTCGGTCCTATACCGTGGGTGTCATGATGATGCACCGGACAGGCCTCTACAACTACTACGACGACGAGAAGGAAAAGCTGCAAATCGTGGAGATGCCCCTGGCCCACAAGCTCTCCAGCCTCATCATCCTCATGCCCCATCACGTGGAGCCTCTCGAGCGCCTTGAAAAGCTGCTAACCAAAGAGCAGCTGAAGATCTGGATGGGGAAGATGCAGAAGAAGGCTGTTGCCATCTCCTTGCCCAAGGGTGTGGTGGAGGTGACCCATGACCTGCAGAAACACCTGGCTGGGCTGGGCCTGACTGAGGCCATTGACAAGAACAAGGCCGACTTGTCACGCATGTCAGGCAAGAAGGACCTGTACCTGGCCAGCGTGTTCCACGCCACCGCCTTTGAGTTGGACACAGATGGCAACCCCTTTGACCAGGACATCTACGGGCGCGAGGAGCTGCGCAGCCCCAAGCTGTTCTACGCCGACCACCCCTTCATCTTCCTAGTGCGGGACACCCAAAGCGGCTCCCTGCTATTCATTGGGCGCCTGGTCCGGCCTAAGGGTGACAAGATGCGAGACGAGTTATAGGGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAGGTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTCCCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACCTGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTACCTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCCAGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCGCAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGTGGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTTGCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACATTTTGTTGGAGCGTGGAAGAAGATTGGATCAGGAGATTCTTACACCATTCTTCCCAGGGGACAAGGTCTCCTGTTAAGGCAGACTCGCTACTGATGGCTCATATCAGGCCCTGGAATGCTGGCAGATCGCTGGCAGATCACTGTGCAGACAGCGCCAAGTGGCAGGTGCATTCCGTGCTGACCCGGGAAATGGTTCTGGCTCTGGCAGCCCTGGAGAAGTAGCAGCTGCAGGACCTGAATGAGAGCACTGGACCTGGAGCCAGTCTTCAGCCTCTTCGCCTTTCTTTCTTTACCCTTTTTTTAAGATGTGAATCTTGCTATATTGCCCAGGCTGGACTCAAACTCCTGGGTTCCAGCGAACCTCCTTCCTCAGCCTCCTGAGTAG