Transcript asmbl_20012

Sequence
Transcript Sequence for observation asmbl_20012 of TGE0059297:
CAATCGTTCTGGGAAGCGATAGAGGCCGGCCTGAATTCTCTGTGGCAAGGGAGGGGAGCCCAAGTGGGAGGCCCCTTGGGGACACCGAGGACCAGGTCCGCTACTGCTCCTCCCCCAGGAGGTCCCCTAGGGGCTACATTGGCTGGCAGGGGCTGAGCAGCGGTGAGCCTGGCTGGCTTCGACCCGGGGCGACTCCGGGCATCCGGGACAGCTTCTCCTCGCTGCCACCTCGGCCAGTCAGACCCCGAGACACCTGTCACTACCCCCTCAGCCTTCCCAAGCCAGGAGCCTGGGAGTCCGGCTCTGGCCTACCTCCGGCAGCGCTCCTAGGCGCAGCTCCCGGGCTGGCGGCGCCGGGGCCCGCCCCCTAGGGCTGCGGCGCGCGGGGCGGGGGCTGGGGGCTGCGCGGGGCGGGGCGGGCCCGGGCGCTCCGGGCCCCCTCCCCCGCCCCCCTGACGTCAGCCCCCGGCAGCCTCGAGCTGCTCACTTGGCTCTCGCCCTCCGGCCGGGAAGCATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTGAGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAAGGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACTCTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACAAAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTACCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGTTTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACCACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCGCGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGAACCCCAGCACCAGGGAGGCAGAGGAAGAGACAACCAACGACAACGGGGTCCTGGTGCTGGAGCCTGCCCGGAAGGAACACAGTGGGCGCTATGAATGTCAGGGCCTGGACTTGGACACCATGATATCGCTGCTGAGTGAACCACAGGAACTACTGGTGAACTATGTGTCTGACGTCCGAGTGAGTCCCGCAGCCCCTGAGAGACAGGAAGGCAGCAGCCTCACCCTGACCTGTGAGGCAGAGAGTAGCCAGGACCTCGAGTTCCAGTGGCTGAGAGAAGAGACAGGCCAGGTGCTGGAAAGGGGGCCTGTGCTTCAGTTGCATGACCTGAAACGGGAGGCAGGAGGCGGCTATCGCTGCGTGGCGTCTGTGCCCAGCATACCCGGCCTGAACCGCACACAGCTGGTCAACGTGGCCATTTTTGGCCCCCCTTGGATGGCATTCAAGGAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGGTAAGCCAGGCCTGGCAAGAGAACAGGGCTGTGCCAGGGCATCCTTTCTGCCCTGTCCCTCCCCAGAGAGCCCTGTCCAGAAAGGTGAGTAGCAGCCCCATCTTGTCGGCCCTGGACTGGCTGGGCCAACGATGGTGACGAAGTGGCCTGGGGCAGGGAGTGACGAGGAGTGTCTTTGTGGCGCAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCTGGTCCTGGCGGTGCTGGGCGCTGTCCTCTATTTCCTCTATAAGAAGGGCAAGCTGCCGTGCAGGCGCTCAGGGAAGCAGGAGATGTAAGCCCAACACCGGCCCCTCCGCCCCCGCCCGTTTTGCCACCCAGCCTGCTGCCTGCCCAGCGCCCGCCTGCCCCTTGACAGCAGGAGTGGGGCCCTGGGTCAGGGTGCTGCCTGCTCCACTACCCACTGCCCAGCTTCCATCAGCCACATGGTCTCATGACCTGCTTCCCTGCCCTGGGCTGGCCCTGGAGCAAGGAGCCCTCATCCATTCCACATCCTTCACAGCGGGCCCTTCTCTTCCTGTGGCCCTGAGATACCAACCTCTCACCTCCCTCCCTCCTCCCAGCACGCTACCCCCGTCTCGTAAGAGCGAACTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTGCAGGGCAGCAGCGGTGACAAGAGGGCTCCGGGAGACCAGGTAGGAGGCGGTTCCTGTGGCCAGAGCCTGCCACATCCTCAGGGACCGGGGGCAGTAGGGACTAACGGTTCTCTCTATCCTTCATCCCTCTTTGTCAGAGATAGGGAGCAGGCCCCATCTTGCCTTCTTAACACTACTCACAGATGGCAGGGCCAAGCAAGTGGCTGAGGGAGCTTGGAGGAAGACTGAGAAAGACCCTGTCCCATCACCTTTTCCTGACCAATGCCCGTGGCTCTGGGTGTGGCCATTTCACCAGTGCAGTCAGACGGGGGCCGCCCTCCTTCCCTGGCCTGCCATGCCCATCCTAGCTTCCTCCCCAACGCTGCCCACCAAATTCATCGGCTTCTGCTTCCATCTCTCCTTCCTCTCGGTGCTCACACCTTCAACTCAGCACCGTCTCCGTGTTCCCCTCTTCTCCTCTACCCACTTTTAGGGAGAGAAATACATCGATCTGAGGCATTAGCCCCGAATCACTTCAGCTCCCTTCCCTGCCTGGACCATTCCCAGCTCCCTGCTCACTCTTCTCTCAGCCAAAGCCTCCAAAGGGACTAGAGAGAAGCCTCCTGCTCCCCTCGCCTGCACACCCCCTTTCAGAGGGCCACTGGGTTAGGACCTGAGGACCTCACTTGGCCCTGCAAGGCCCGCTTTTCAGGGACCAGTCCACCACCATCTCCTCCACGTTGAGTGAAGCTCATCCCAAGCAAGGAGCCCCAGTCTCCCGAGCGGGTAGGAGAGTTTCTTGCAGAACGTGTTTTTTCTTTACACACATTATGGCTGTAAATACCTGGCTCCTGCCAGCAGCTGAGCTGGGTAGCCTCTCTGAGCTGGTTTCCTGCCCCAAAGGCTGGCTTCCACCATCCAGGTGCACCACTGAAGTGAGGACACACCGGAGCCAGGCGCCTGCTCATGTTGAAGTGCGCTGTTCACACCCGCTCCGGAGAGCACCCCAGCAGCATCCAGAAGCAGCTGCAGTGTTGCTGCCACCACCCTCCTGTCTGCCTCTTCAAAGTCTCCTGTGACATTTTTTCTTTGGTCAGAAGCCAGGAACTGGTGTCATTCCTTAAAAGATACGTGCCGGGGCCAGGTGTGGTGGCTCACGCC