Transcript asmbl_12672

Sequence
Transcript Sequence for observation asmbl_12672 of TGE0056448:
CCCTCCCCCGGCTCCCCGCCCACCTCGCGCGCCCCTCCCCCCGGGTCGCGCGCCGCGGGCCCGAGCGCGAGACGCCGCTGCTCCCGCCCCCGCCGCCTCCTGGAGTCGCCGGGGCGGACGCGCAGTCCATGGGGCGCGGTGGGCCGGGGAGTTGCCCCAGGGGCCGCGGGAGTTGCTGAGAGGAGACAGGGTTGGGCTTTCTCCTCGCCCAGACCCCACCCCACCCTGCCGACCCCACCCCCTGCTCCTTCCTCCCCGGGGGCGCGCACTCGGGCACGCGCTCGGAAGTCGGGGGTCGGCGCGGAGTGCAGGCTGCTCCCGGGGTAGGTGAGGGAAGCGCGGAGGCGGCGCGCGGGGGCAGTGGTCGGCGAGCAGCGCGGTCCTCGCTAGGGGCGCCCACCCGTCAGTCTCTCCGGCGCGAGCCGCCGCCACCGCCCGCGCCGGAGTCAGGCCCCTGGGCCCCCAGGCTCAAGCAGCGAAGCGGCCTCCGGGGGACGCCGCTAGGCGAGAGGAACGCGCCGGTGCCCTTGCCTTCGCCGTGACCCAGCGTGCGGGCGGCGGGATGAGAGGGAGCCATCGGGCCGCGCCGGCCCTGCGGCCCCGGGGGCGGCTCTGGCCCGTGCTGGCCGTGCTGGCGGCGGCCGCCGCGGCGGGCTGTGCCCAGGCAGCCATGGACGAGTGCACGGACGAGGGCGGGCGGCCGCAGCGCTGCATGCCCGAGTTCGTCAACGCCGCCTTCAACGTGACTGTGGTGGCCACCAACACGTGTGGGACTCCGCCCGAGGAATACTGTGTGCAGACCGGGGTGACCGGGGTCACCAAGTCCTGTCACCTGTGCGACGCCGGGCAGCCCCACCTGCAGCACGGGGCAGCCTTCCTGACCGACTACAACAACCAGGCCGACACCACCTGGTGGCAAAGCCAGACCATGCTGGCCGGGGTGCAGTACCCCAGCTCCATCAACCTCACGCTGCACCTGGGAAAAGCTTTTGACATCACCTATGTGCGTCTCAAGTTCCACACCAGCCGCCCGGAGAGCTTTGCCATTTACAAGCGCACACGGGAAGACGGGCCCTGGATTCCTTACCAGTACTACAGTGGTTCCTGTGAGAACACCTACTCCAAGGCAAACCGCGGCTTCATCAGGACAGGAGGGGACGAGCAGCAGGCCTTGTGTACTGATGAATTCAGTGACATTTCTCCCCTCACTGGGGGCAACGTGGCCTTTTCTACCCTGGAAGGAAGGCCCAGCGCCTATAACTTTGACAATAGCCCTGTGCTGCAGGAATGGGTAACTGCCACTGACATCAGAGTAACTCTTAATCGCCTGAACACTTTTGGAGATGAAGTGTTTAACGATCCCAAAGTTCTCAAGTCCTATTATTATGCCATCTCTGATTTTGCTGTAGGTGGCAGATGTAAATGTAATGGACACGCAAGCGAGTGTATGAAGAACGAATTTGATAAGCTGGTGTGTAATTGCAAACATAACACATATGGAGTAGACTGTGAAAAGTGTCTTCCTTTCTTCAATGACCGGCCGTGGAGGAGGGCAACTGCGGAAAGTGCCAGTGAATGCCTGCCCTGTGATTGCAATGGTCGATCCCAGGAATGCTACTTCGACCCTGAACTCTATCGTTCCACTGGCCATGGGGGCCACTGTACCAACTGCCAGGATAACACAGATGGCGCCCACTGTGAGAGGTGCCGAGAGAACTTCTTCCGCCTTGGCAACAATGAAGCCTGCTCTTCATGCCACTGTAGTCCTGTGGGCTCTCTAAGCACACAGTGTGATAGTTACGGCAGATGCAGCTGTAAGCCAGGAGTGATGGGGGACAAATGTGACCGTTGCCAGCCTGGATTCCATTCTCTCACTGAAGCAGGATGCAGGCCATGCTCTTGTGATCCCTCTGGCAGCATAGATGAATGTAATATTGAAACAGGAAGATGTGTTTGCAAAGACAATGTCGAAGGCTTCAATTGTGAAAGATGCAAACCTGGATTTTTTAATCTGGAATCATCTAATCCTCGGGGTTGCACACCCTGCTTCTGCTTTGGGCATTCTTCTGTCTGTACAAACGCTGTTGGCTACAGTGTTTATTCTATCTCCTCTACCTTTCAGATTGATGAGGATGGGTGGCGTGCGGAACAGAGAGATGGCTCTGAAGCATCTCTCGAGTGGTCCTCTGAGAGGCAAGATATCGCCGTGATCTCAGACAGCTACTTTCCTCGGTACTTCATTGCTCCTGCAAAGTTCTTGGGCAAGCAGGTGTTGAGTTATGGTCAGAACCTCTCCTTCTCCTTTCGAGTGGACAGGCGAGATACTCGCCTCTCTGCAGAAGACCTTGTGCTTGAGGGAGCTGGCTTAAGAGTATCTGTACCCTTGATCGCTCAGGGCAATTCCTATCCAAGTGAGACCACTGTGAAGTATGTCTTCAGGCTCCATGAAGCAACAGATTACCCTTGGAGGCCTGCTCTTACCCCTTTTGAATTTCAGAAGCTCCTAAACAACTTGACCTCTATCAAGATACGTGGGACATACAGTGAGAGAAGTGCTGGATATTTGGATGATGTCACCCTGGCAAGTGCTCGTCCTGGGCCTGGAGTCCCTGCAACTTGGGTGGAGTCCTGCACCTGTCCTGTGGGATATGGAGGGCAGTTTTGTGAGATGTGCCTCTCAGGTTACAGAAGAGAAACTCCTAATCTTGGACCATACAGTCCATGTGTGCTTTGCGCCTGCAATGGACACAGCGAGACCTGTGATCCTGAGACAGGTGTTTGTAACTGCAGAGACAATACGGCTGGCCCGCACTGTGAGAAGTGCAGTGATGGGTACTATGGAGATTCAACTGCAGGCACCTCCTCCGATTGCCAACCCTGTCCGTGTCCTGGAGGTTCAAGTTGTGCTGTTGTTCCCAAGACAAAGGAGGTGGTGTGCACCAACTGTCCTACTGGCACCACTGGTAAGAGATGTGAGCTCTGTGATGATGGCTACTTTGGAGACCCCCTGGGTAGAAACGGCCCTGTGAGACTTTGCCGCCTGTGCCAGTGCAGTGACAACATCGATCCCAATGCAGTTGGAAATTGCAATCGCTTGACGGGAGAATGCCTGAAGTGCATCTATAACACTGCTGGCTTCTATTGTGACCGGTGCAAAGACGGATTTTTTGGAAATCCCCTGGCTCCCAATCCAGCAGACAAATGCAAAGCCTGCAATTGCAATCTGTATGGGACCATGAAGCAGCAGAGCAGCTGTAACCCCGTGACGGGGCAGTGTGAATGTTTGCCTCACGTGACTGGCCAGGACTGTGGTGCTTGTGACCCTGGATTCTACAATCTGCAGAGTGGGCAAGGCTGTGAGAGGTGTGACTGCCATGCCTTGGGCTCCACCAATGGGCAGTGTGACATCCGCACCGGCCAGTGTGAGTGCCAGCCCGGCATCACTGGTCAGCACTGTGAGCGCTGTGAGGTCAACCACTTTGGGTTTGGACCTGAAGGCTGCAAACCCTGTGACTGTCATCCTGAGGGATCTCTTTCACTTCAGTGCAAAGATGATGGTCGCTGTGAATGCAGAGAAGGCTTTGTGGGAAATCGCTGTGACCAGTGTGAAGAAAACTATTTCTACAATCGGTCTTGGCCTGGCTGCCAGGAATGTCCAGCTTGTTACCGGCTGGTAAAGGATAAGGTTGCTGATCATAGAGTGAAGCTCCAGGAATTAGAGAGTCTCATAGCAAACCTTGGAACTGGGGATGAGATGGTGACAGATCAAGCCTTCGAGGATAGACTAAAGGAAGCAGAGAGGGAAGTTATGGACCTCCTTCGTGAGGCCCAGGATGTCAAAGATGTTGACCAGAATTTGATGGATCGCCTACAGAGAGTGAATAACACTCTGTCCAGCCAAATTAGCCGTTTACAGAATATCCGGAATACCATTGAAGAGACTGGAAACTTGGCTGAACAAGCGCGTGCCCATGTAGAGAACACAGAGCGGTTGATTGAAATCGCATCCAGAGAACTTGAGAAAGCAAAAGTCGCTGCTGCCAATGTGTCAGTCACTCAGCCAGAATCTACAGGGGACCCAAACAACATGACTCTTTTGGCAGAAGAGGCTCGAAAGCTTGCTGAACGTCATAAACAGGAAGCTGATGACATTGTTCGAGTGGCAAAGACAGCCAATGATACGTCAACTGAGGCATACAACCTGCTTCTGAGGACACTGGCAGGAGAAAATCAAACAGCATTTGAGATTGAAGAGCTTAATAGGAAGTATGAACAAGCGAAGAACATCTCACAGGATCTGGAAAAACAAGCTGCCCGAGTACATGAGGAGGCCAAAAGGGCCGGTGACAAAGCTGTGGAGATCTATGCCAGCGTGGCTCAGCTGAGCCCTTTGGACTCTGAGACACTGGAGAATGAAGCAAATAACATAAAGATGGAAGCTGAGAATCTGGAACAACTGATTGACCAGAAATTAAAAGATTATGAGGACCTCAGAGAAGATATGAGAGGGAAGGAACTTGAAGTCAAGAACCTTCTGGAGAAAGGCAAGACTGAACAGCAGACCGCAGACCAACTCCTAGCCCGAGCTGATGCTGCCAAGGCCCTCGCTGAAGAAGCTGCAAAGAAGGGACGGGATACCTTACAAGAAGCTAATGACATTCTCAACAACCTGAAAGATTTTGATAGGCGTGTGAACGATAACAAGACGGCCGCAGAGGAGGCACTAAGGAAGATTCCTGCCATCAACCAGACCATCACTGAAGCCAATGAAAAGACCAGAGAAGCCCAGCAGGCCCTGGGCAGTGCTGCGGCGGATGCCACAGAGGCCAAGAACAAGGCCCATGAGGCGGAGAGGATCGCGAGCGCTGTCCAAAAGAATGCCACCAGCACCAAGGCAGAAGCTGAAAGAACTTTTGCAGAAGTTACAGATCTGGATAATGAGGTGAACAATATGTTGAAGCAACTGCAGGAAGCAGAAAAAGAGCTAAAGAGAAAACAAGATGACGCTGACCAGGACATGATGATGGCAGGGATGGCTTCACAGGCTGCTCAAGAAGCCGAGATCAATGCCAGAAAAGCCAAAAACTCTGTTACTAGCCTCCTCAGCATTATTAATGACCTCTTGGAGCAGCTGGGGCAGCTGGATACAGTGGACCTGAATAAGCTAAACGAGATTGAAGGCACCCTAAACAAAGCCAAAGATGAAATGAAGGTCAGCGATCTTGATAGGAAAGTGTCTGACCTGGAGAATGAAGCCAAGAAGCAGGAGGCTGCCATCATGGACTATAACCGAGATATCGAGGAGATCATGAAGGACATTCGCAATCTGGAGGACATCAGGAAGACCTTACCATCTGGCTGCTTCAACACCCCGTCCATTGAAAAGCCCTAGTGTCTTTAGGGCTGGAAGGCAGCATCCCTCTGACAGGGGGGCAGTTGTGAGGCCACAGAGTGCCTTGACACAAAGATTACATTTTTCAGACCCCCACTCCTCTGCTGCTGTCCATGACTGTCCTTTTGAACCAGGAAAAGTCACAGAGTTTAAAGAGAAGCAAATTAAACATCCTGAATCGGGAACAAAGGGTTTTATCTAATAAAGTGTCTCTTCCATTCACGTTGCTACCTTACCCACACTTTCCCTTCTGATTTGCGTGAGGACGTGGCATCCTACGTTACTGTACAGTGGCATAAGCACATCGTGTGAGCCCATGTATGCTGGGGTAGAGCAAGTAGCCCTCCCCTGTCTCATCGATACCAGCAGAACCTCCTCAGTCTCAGTACTCTTGTTTCTATGAAGGAAAAGTTTGGCTACTAACAGTAGCATTGTGATGGCCAGTATATCCAGTCCATGGATAAAGAAAATGCATCTGCATCTCCTACCCCTCTTCCTTCTAAGCAAAAGGAAATAAACATCCTGTGCCAAAGGTATTGGTCATTTAGAATGTCGGTAGCCATCCATCAGTGCTTTTAGTTATTATGAGTGTAGGACACTGAGCCATCCGTGGGTCAGGATGCAATTATTTATAAAAGTCTCCAGGTGAACATGGCTGAAGATTTTTCTAGTATATTAATAATTGACTAGGAAGATGAACTTTTTTTCAGATCTTTGGGCAGCTGATAATTTAAATCTGGATGGGCAGCTTGCACTCACCAATAGACCAAAAGACATCTTTTGATATTCTTATAAATGGAACTTACACAGAAGAAATAGGGATATGATAACCACTAAAATTTTGTTTTCAAAATCAAACTAATTCTTACAGCTTTTTTATTAGTTAGTCTTGGAACTAGTGTTAAGTATCTGGCAGAGAACAGTTAATCCCTAAGGTCTTGACAAAACAGAAGAAAAACAAGCCTCCTCGTCCTAGTCTTTTCTAGCAAAGGGATAAAACTTAGATGGCAGCTTGTACTGTCAGAATCCCGTGTATCCATTTGTTCTTCTGTTGGAGAGATGAGACATTTGACCCTTAGCTCCAGTTTTCTTCTGATGTTTCCATCTTCCAGAATCCCTCAAAAAACATTGTTTGCCAAATCCTGGTGGCAAATACTTGCACTCAGTATTTCACACAGCTGCCAACGCTATCGAGTTCCTGCACTTTGTGATTTAAATCCACTCTAAACCTTCCCTCTAAGTGTAGAGGGAAGACCCTTACGTGGAGTTTCCTAGTGGGCTTCTCAACTTTTGATCCTCAGCTCTGTGGTTTTAAGACCACAGTGTGACAGTTCCCTGCCACACACCCCCTTCCTCCTACCAACCCACCTTTGAGATTCATATATAGCCTTTAACACTATGCAACTTTGTACTTTGCGTAGCAGGGGCGGGGTGGGGGGAAAGAAACTATTATCTGACACACTGGTGCTATTAATTATTTCAAATTTATATTTTTGTGTGAATGTTTTGTGTTTTGTTTATCATGATTATAGAATAAGGAATTTATGTAAATATACTTAGTCCTATTTCTAGAATGACACTCTGTTCACTTTGCTCAATTTTTCCTCTTCACTGGCACAATGTATCTGAATACCTCCTTCCCTCCCTTCTAGAATTCTTTGGATTGTACTCCAAAGAATTGTGCCTTGTGTTTGCAGCATCTCCATTCTCTAAAATTAATATAATTGCTTTCCTCCACACCCAGCCACTGTAAAGAGGTAACTTGGGTCCTCTTCCATTGCAGTCCTGATGATCCTAACCTGCAGCACGGTGGTTTTACAATGTTCCAGAGCAGGAACGCCAGGTTGACAAGCTATGGTAGGATTAGGAAAGTTTGCTGAAGAGGATCTTTGACGCCACAGTGGGACTAGCCAGGAATGAGGGAGAAATGCCCTTTCTGGCAATTGTTGGAGCTGGATAGGTAAGTTTTATAAGGGAGTACATTTTGACTGAGCACTTAGGGCATCAGGAACAGTGCTACTTACTGATGGGTAGACTGGGAGAGGTGGTGTAACTTAGTTCTTGATGATCCCACTTCCTGTTTCCATCTGCTTGGGATATACCAGAGTTTACCACAAGTGTTTTGACGATATACTCCTGAGCTTTCACTCTGCTGCTTCTCCCAGGCCTCTTCTACTATGGCAGGAGATGTGGCGTGCTGTTGCAAAGTTTTCACGTCATTGTTTCCTGGCTAGTTCATTTCATTAAGTGGCTACATCCTAACATATGCATTTGGTCAAGGTTGCAGAAGAGGACTGAAGATTGACTGCCAAGCTAGTTTGGGTGAAGTTCACTCCAGCAAGTCTCAGGCCACAATGGGGTGGTTTGGTTTGGTTTCCTTTTAACTTTCTTTTTGTTATTTGCTTTTCTCCTCCACCTGTGTGGTATATTTTTTAAGCAGAATTTTATTTTTTAAAATAAAAGGTTCTTTACAAGATGATACCTTAATTACACTCCCGCAACACAGCCATTATTTTATTGTCTAGCTCCAGTTATCTGTATTTTATGTAATGTAATTGACAGGATGGCTGCTGCAGAATGCTGGTTGACACAGGGATTATTATACTGCTATTTTTCCCTGAATTTTTTTCCTTTGAATTCCAACTGTGGACCTTTTATATGTGCCTTCACTTTAGCTGTTTGCCTTAATCTCTACAGCCTTGCTCTCCGGGGTGGTTAATAAAATGCAACACTTGGCATTTTTATGTTTTAAGAAAAACAGTATTTTATTTATAATAAAATCTGAATATTTGTAACCCTTTATATTTGGTGTGGCCTGAGTGTGGTACTGGGGACATAAGATGTTTTAAAAGGTATAATGAATGAAAAGC