Transcript asmbl_117989

Sequence
Transcript Sequence for observation asmbl_117989 of TGE0056079:
AAGGAAATGATTGGATCTCATTCCCAATTGGTCATTCCTAAGATCACATGTTCTGAGCATCTTTAAAAGGAAGTTATCTGGACTCAAGAGGGTCACAGCACCCTCCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGTATTCATTGTGCTTATGATGTATTCTTAGTCATAACTGAGTGAAGGAAATGGGAAATTTGCATTATTTCTTTGTTCTGATATGAATAATAACATATTTCATAATAATTCAAGGTAAAAAGGGATATCTATGGATTTCCCTAGGTAGGAGATAACAAGTATGTACCATTACTGAATATTAAATCCTTCTTTACCATAGCTACAGTTAAGTAGGTGTATCTCAGAAACCTAAGGTAGTTTTAAATGTAGTGAAATTGTCCACAGCAAGCTGGCCCAAGTGCTCACATTTTATACCCGCTCTGTCTTAGTGCGTTGCAAGAGAGGAGTATATACAGTAGTTCCCCCTTATCCACAGGGGTACATTCTAAGACCCCCGGTGGGTGACTGAAACCACAGATAGTACCGAATCTTATACATACTATGTTTTTTTTCTAAACATAAATACCTACAATAAAGTTTAATTTTTAAATTAGGCACCATAATTAATAATAAAACAGAACAGTTATAACAATATACTATAATAAAATTATGTGTATGTGATCTCTCTTTCTCTCTCCCTCTCAAAATATTTTTAATATCTCTCCAGAATTCAGTGCAAATAATTCCATCATACTCACTTCAGAAAAGTGAAGATAGTCTTGTACATGAGTAGATTCAAATTTTATTGTCGTGGTTTCCAAAGTTTTATTTTTCTCACCAATGGAACTTTTGATTCAAATAAAATATCCAAGGGATTTCAGCTTATAAAACACACAAAATTGATAATGAGTTTTCCAAGGTACTGTGTGTGTGAATGTGTATGTCTGTGTATGTGTGTGTCGTCTGTATGTTTTTCCCACCTCTTGTAGAAGCTACGAAGCACCTTTCCATATTATTGAGGTTTCCTGTACGTAGACTGAAATTTACAAATCACATGCTTACATTTTATAGTAAGACAAAATCTGCCAAAGTGTATATTGCTGTTGATATAATTCTGTTTGTGATTCTCTCTTTAAAAATAAATCCAAAGGTTTTCATTTCCTGCATACTTATCCTATGCATAACACCATGATATGCAGAGGCCAGAAGAGATGGACTA